EMAIL THIS PAGE TO A FRIEND

C16orf46

chromosome 16 open reading frame 46

42 Gene Product Result for
Species: Human C16orf46(123775)
UniProtKB ID: Q6P387, Q96MA7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152337 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028641 MISSION® esiRNA esiRNA human C16orf46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100873 Rosetta Predictions human pricing
NM_152337 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322407 predicted 908
2 SASI_Hs02_00322408 predicted 619
3 SASI_Hs02_00322409 predicted 336
4 SASI_Hs02_00322410 predicted 462
5 SASI_Hs02_00322411 predicted 832
6 SASI_Hs02_00322412 predicted 652
7 SASI_Hs02_00322413 predicted 769
8 SASI_Hs02_00322414 predicted 1055
9 SASI_Hs02_00322415 predicted 975
10 SASI_Hs02_00322416 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365950 predicted 996
2 SASI_Hs01_00025326 predicted 707
3 SASI_Hs01_00025328 predicted 432
4 SASI_Hs01_00025329 predicted 557
5 SASI_Hs02_00365951 predicted 924
6 SASI_Hs02_00365952 predicted 742
7 SASI_Hs02_00365953 predicted 865
8 SASI_Hs02_00365954 predicted 1147
9 SASI_Hs02_00365955 predicted 1060
10 SASI_Hs02_00365956 predicted 1064
11 SASI_Hs01_00025325 predicted 332
12 SASI_Hs01_00025327 predicted 276
13 SASI_Hs01_00025330 predicted 1161
14 SASI_Hs01_00025331 predicted 878
15 SASI_Hs01_00025332 predicted 1221
16 SASI_Hs01_00025333 predicted 675
17 SASI_Hs01_00025334 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152337
C16orf46 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 46
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152337.1-1396s1c1
Sequence:CCGGCCCTGGGAATAAGCACCGTTTCTCGAGAAACGGTGCTTATTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-690s1c1
Sequence:CCGGGAGTTTATTTGGTGCAACAAACTCGAGTTTGTTGCACCAAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-678s1c1
Sequence:CCGGCTGCAAATCAAGGAGTTTATTCTCGAGAATAAACTCCTTGATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-321s1c1
Sequence:CCGGCTTCTCGATGTCAGTGACATTCTCGAGAATGTCACTGACATCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-1241s1c1
Sequence:CCGGCCGAAAGCATGTTCTCCCAAACTCGAGTTTGGGAGAACATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-1331s1c1
Sequence:CCGGCACAGTGAGCAGAGTTATCATCTCGAGATGATAACTCTGCTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-330s1c1
Sequence:CCGGGTCAGTGACATTACGCTTGAACTCGAGTTCAAGCGTAATGTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-1339s1c1
Sequence:CCGGGCAGAGTTATCATTCCTGTCTCTCGAGAGACAGGAATGATAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-881s1c1
Sequence:CCGGGAACTCTTTCTTGCAGTCAGACTCGAGTCTGACTGCAAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-627s1c1
Sequence:CCGGGCAATTAGCGACATCTGCTTTCTCGAGAAAGCAGATGTCGCTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-327s1c1
Sequence:CCGGGATGTCAGTGACATTACGCTTCTCGAGAAGCGTAATGTCACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152337
C16orf46 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 46
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152337.1-1396s1c1
Sequence:CCGGCCCTGGGAATAAGCACCGTTTCTCGAGAAACGGTGCTTATTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-690s1c1
Sequence:CCGGGAGTTTATTTGGTGCAACAAACTCGAGTTTGTTGCACCAAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-678s1c1
Sequence:CCGGCTGCAAATCAAGGAGTTTATTCTCGAGAATAAACTCCTTGATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-321s1c1
Sequence:CCGGCTTCTCGATGTCAGTGACATTCTCGAGAATGTCACTGACATCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-1241s1c1
Sequence:CCGGCCGAAAGCATGTTCTCCCAAACTCGAGTTTGGGAGAACATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-1331s1c1
Sequence:CCGGCACAGTGAGCAGAGTTATCATCTCGAGATGATAACTCTGCTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-330s1c1
Sequence:CCGGGTCAGTGACATTACGCTTGAACTCGAGTTCAAGCGTAATGTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-1339s1c1
Sequence:CCGGGCAGAGTTATCATTCCTGTCTCTCGAGAGACAGGAATGATAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-881s1c1
Sequence:CCGGGAACTCTTTCTTGCAGTCAGACTCGAGTCTGACTGCAAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-627s1c1
Sequence:CCGGGCAATTAGCGACATCTGCTTTCTCGAGAAAGCAGATGTCGCTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-327s1c1
Sequence:CCGGGATGTCAGTGACATTACGCTTCTCGAGAAGCGTAATGTCACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152337
C16orf46 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 46
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152337.1-1396s1c1
Sequence:CCGGCCCTGGGAATAAGCACCGTTTCTCGAGAAACGGTGCTTATTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-690s1c1
Sequence:CCGGGAGTTTATTTGGTGCAACAAACTCGAGTTTGTTGCACCAAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-678s1c1
Sequence:CCGGCTGCAAATCAAGGAGTTTATTCTCGAGAATAAACTCCTTGATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-321s1c1
Sequence:CCGGCTTCTCGATGTCAGTGACATTCTCGAGAATGTCACTGACATCGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-1241s1c1
Sequence:CCGGCCGAAAGCATGTTCTCCCAAACTCGAGTTTGGGAGAACATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-1331s1c1
Sequence:CCGGCACAGTGAGCAGAGTTATCATCTCGAGATGATAACTCTGCTCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-330s1c1
Sequence:CCGGGTCAGTGACATTACGCTTGAACTCGAGTTCAAGCGTAATGTCACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152337.1-1339s1c1
Sequence:CCGGGCAGAGTTATCATTCCTGTCTCTCGAGAGACAGGAATGATAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-881s1c1
Sequence:CCGGGAACTCTTTCTTGCAGTCAGACTCGAGTCTGACTGCAAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-627s1c1
Sequence:CCGGGCAATTAGCGACATCTGCTTTCTCGAGAAAGCAGATGTCGCTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152337.1-327s1c1
Sequence:CCGGGATGTCAGTGACATTACGCTTCTCGAGAAGCGTAATGTCACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks