EMAIL THIS PAGE TO A FRIEND

C16orf47

chromosome 16 open reading frame 47

59 Gene Product Result for
Species: Human C16orf47(388289)
UniProtKB ID: Q6ZP98
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207385 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207385 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246000 predicted 779
2 SASI_Hs01_00246001 predicted 720
3 SASI_Hs01_00246002 predicted 664
4 SASI_Hs01_00246003 predicted 578
5 SASI_Hs01_00246004 predicted 790
6 SASI_Hs01_00246005 predicted 794
7 SASI_Hs01_00246006 predicted 564
8 SASI_Hs01_00246007 predicted 920
9 SASI_Hs01_00246008 predicted 525
10 SASI_Hs01_00246009 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207385
C16orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 47
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-658s1c1
Sequence:CCGGCCTGTCAGTTTCCTCCACATTCTCGAGAATGTGGAGGAAACTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-870s1c1
Sequence:CCGGCCGTCTCTTAGACAAGCTGAACTCGAGTTCAGCTTGTCTAAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-222s1c1
Sequence:CCGGGAGAAGCTGAGACACAAAGAACTCGAGTTCTTTGTGTCTCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-218s1c1
Sequence:CCGGGATAGAGAAGCTGAGACACAACTCGAGTTGTGTCTCAGCTTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-240s1c1
Sequence:CCGGGAAGTTAACAAGAGCCAGCAACTCGAGTTGCTGGCTCTTGTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-236s1c1
Sequence:CCGGCAAAGAAGTTAACAAGAGCCACTCGAGTGGCTCTTGTTAACTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-227s1c1
Sequence:CCGGGCTGAGACACAAAGAAGTTAACTCGAGTTAACTTCTTTGTGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-230s1c1
Sequence:CCGGGAGACACAAAGAAGTTAACAACTCGAGTTGTTAACTTCTTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-830s1c1
Sequence:CCGGGCTAATTCATTTCAGGTGGATCTCGAGATCCACCTGAAATGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-566s1c1
Sequence:CCGGCAGCCATTCAGTTAAGTGGAACTCGAGTTCCACTTAACTGAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207385
C16orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 47
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-658s1c1
Sequence:CCGGCCTGTCAGTTTCCTCCACATTCTCGAGAATGTGGAGGAAACTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-870s1c1
Sequence:CCGGCCGTCTCTTAGACAAGCTGAACTCGAGTTCAGCTTGTCTAAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-222s1c1
Sequence:CCGGGAGAAGCTGAGACACAAAGAACTCGAGTTCTTTGTGTCTCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-218s1c1
Sequence:CCGGGATAGAGAAGCTGAGACACAACTCGAGTTGTGTCTCAGCTTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-240s1c1
Sequence:CCGGGAAGTTAACAAGAGCCAGCAACTCGAGTTGCTGGCTCTTGTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-236s1c1
Sequence:CCGGCAAAGAAGTTAACAAGAGCCACTCGAGTGGCTCTTGTTAACTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-227s1c1
Sequence:CCGGGCTGAGACACAAAGAAGTTAACTCGAGTTAACTTCTTTGTGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-230s1c1
Sequence:CCGGGAGACACAAAGAAGTTAACAACTCGAGTTGTTAACTTCTTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-830s1c1
Sequence:CCGGGCTAATTCATTTCAGGTGGATCTCGAGATCCACCTGAAATGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-566s1c1
Sequence:CCGGCAGCCATTCAGTTAAGTGGAACTCGAGTTCCACTTAACTGAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207385
C16orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 47
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-658s1c1
Sequence:CCGGCCTGTCAGTTTCCTCCACATTCTCGAGAATGTGGAGGAAACTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-870s1c1
Sequence:CCGGCCGTCTCTTAGACAAGCTGAACTCGAGTTCAGCTTGTCTAAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-222s1c1
Sequence:CCGGGAGAAGCTGAGACACAAAGAACTCGAGTTCTTTGTGTCTCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-218s1c1
Sequence:CCGGGATAGAGAAGCTGAGACACAACTCGAGTTGTGTCTCAGCTTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-240s1c1
Sequence:CCGGGAAGTTAACAAGAGCCAGCAACTCGAGTTGCTGGCTCTTGTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-236s1c1
Sequence:CCGGCAAAGAAGTTAACAAGAGCCACTCGAGTGGCTCTTGTTAACTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-227s1c1
Sequence:CCGGGCTGAGACACAAAGAAGTTAACTCGAGTTAACTTCTTTGTGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-230s1c1
Sequence:CCGGGAGACACAAAGAAGTTAACAACTCGAGTTGTTAACTTCTTTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207385.1-830s1c1
Sequence:CCGGGCTAATTCATTTCAGGTGGATCTCGAGATCCACCTGAAATGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207385.1-566s1c1
Sequence:CCGGCAGCCATTCAGTTAAGTGGAACTCGAGTTCCACTTAACTGAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks