EMAIL THIS PAGE TO A FRIEND

C16orf54

chromosome 16 open reading frame 54

46 Gene Product Result for
Species: Human C16orf54(283897)
UniProtKB ID: Q6UWD8, A6NJR6, Q8NAB0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175900 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110771 MISSION® esiRNA esiRNA human C16orf54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175900 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125046 predicted 1061
2 SASI_Hs01_00125047 predicted 1061
3 SASI_Hs01_00125048 predicted 493
4 SASI_Hs01_00125049 predicted 1195
5 SASI_Hs01_00125050 predicted 1259
6 SASI_Hs01_00125051 predicted 746
7 SASI_Hs01_00125052 predicted 1065
8 SASI_Hs01_00125053 predicted 837
9 SASI_Hs01_00125054 predicted 254
10 SASI_Hs02_00369166 predicted 1007
11 SASI_Hs01_00125055 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175900
C16orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 54
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1093s1c1
Sequence:CCGGCCTCCACCTTCTTTCAGTGTTCTCGAGAACACTGAAAGAAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1721s1c1
Sequence:CCGGGCAGCAGATGTAGTTTCCATTCTCGAGAATGGAAACTACATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-2373s1c1
Sequence:CCGGGCCAAACTTCAGCCTTGAATACTCGAGTATTCAAGGCTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1025s1c1
Sequence:CCGGCCTTCAAGATCGCATCCAGATCTCGAGATCTGGATGCGATCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1217s1c1
Sequence:CCGGGCCACAAATCCTGTTCTCCTTCTCGAGAAGGAGAACAGGATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1891s1c1
Sequence:CCGGCCCACCTCAACCTCTAGAATACTCGAGTATTCTAGAGGTTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175900.3-259s21c1
Sequence:CCGGTGTGTTGGCTGAACGCCTGTTCTCGAGAACAGGCGTTCAGCCAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175900.3-1128s21c1
Sequence:CCGGACCGAAGCCACCAATACCAAACTCGAGTTTGGTATTGGTGGCTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175900.3-740s21c1
Sequence:CCGGTCAGCTTTCTGGAAGCGTGAACTCGAGTTCACGCTTCCAGAAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175900
C16orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 54
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1093s1c1
Sequence:CCGGCCTCCACCTTCTTTCAGTGTTCTCGAGAACACTGAAAGAAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1721s1c1
Sequence:CCGGGCAGCAGATGTAGTTTCCATTCTCGAGAATGGAAACTACATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-2373s1c1
Sequence:CCGGGCCAAACTTCAGCCTTGAATACTCGAGTATTCAAGGCTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1025s1c1
Sequence:CCGGCCTTCAAGATCGCATCCAGATCTCGAGATCTGGATGCGATCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1217s1c1
Sequence:CCGGGCCACAAATCCTGTTCTCCTTCTCGAGAAGGAGAACAGGATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1891s1c1
Sequence:CCGGCCCACCTCAACCTCTAGAATACTCGAGTATTCTAGAGGTTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175900.3-259s21c1
Sequence:CCGGTGTGTTGGCTGAACGCCTGTTCTCGAGAACAGGCGTTCAGCCAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175900.3-1128s21c1
Sequence:CCGGACCGAAGCCACCAATACCAAACTCGAGTTTGGTATTGGTGGCTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175900.3-740s21c1
Sequence:CCGGTCAGCTTTCTGGAAGCGTGAACTCGAGTTCACGCTTCCAGAAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175900
C16orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 54
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1093s1c1
Sequence:CCGGCCTCCACCTTCTTTCAGTGTTCTCGAGAACACTGAAAGAAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1721s1c1
Sequence:CCGGGCAGCAGATGTAGTTTCCATTCTCGAGAATGGAAACTACATCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168855    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-2373s1c1
Sequence:CCGGGCCAAACTTCAGCCTTGAATACTCGAGTATTCAAGGCTGAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1025s1c1
Sequence:CCGGCCTTCAAGATCGCATCCAGATCTCGAGATCTGGATGCGATCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1217s1c1
Sequence:CCGGGCCACAAATCCTGTTCTCCTTCTCGAGAAGGAGAACAGGATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175900.2-1891s1c1
Sequence:CCGGCCCACCTCAACCTCTAGAATACTCGAGTATTCTAGAGGTTGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175900.3-259s21c1
Sequence:CCGGTGTGTTGGCTGAACGCCTGTTCTCGAGAACAGGCGTTCAGCCAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175900.3-1128s21c1
Sequence:CCGGACCGAAGCCACCAATACCAAACTCGAGTTTGGTATTGGTGGCTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175900.3-740s21c1
Sequence:CCGGTCAGCTTTCTGGAAGCGTGAACTCGAGTTCACGCTTCCAGAAAGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks