EMAIL THIS PAGE TO A FRIEND

C16orf58

chromosome 16 open reading frame 58

64 Gene Product Result for
Synonyms: RUS
Species: Human C16orf58(64755)
UniProtKB ID: Q96GQ5, Q53GL8, Q8NAJ4, Q9BVY3, Q9H887
Gene ID:
Human(64755) Summary: This gene encodes a putative transmembrane protein containing a conserved DUF647 domain that may be involved in protein-protein interaction. The encoded protein is related to a plant protein that participates in ultraviolet B light-sensing during root morphogenesis. [provided by RefSeq, Feb 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA024406 Anti-C16orf58 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100255 Anti-C16ORF58 antibody produced in rabbit affinity isolated antibody rabbit, mouse, canine, guinea pig, bovine, rat, human, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022744 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085681 MISSION® esiRNA esiRNA human C16orf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022744 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132539 predicted 934
2 SASI_Hs01_00132540 predicted 1766
3 SASI_Hs01_00132541 predicted 595
4 SASI_Hs01_00132542 predicted 1276
5 SASI_Hs02_00355995 predicted 308
6 SASI_Hs01_00132543 predicted 1700
7 SASI_Hs01_00132544 predicted 1732
8 SASI_Hs01_00132545 predicted 465
9 SASI_Hs01_00132546 predicted 603
10 SASI_Hs01_00132547 predicted 1674
11 SASI_Hs01_00132548 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022744
VALIDATED
C16orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 58
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022744.1-2345s21c1
Sequence:CCGGGAGCTTGTGTTTAAAGCCGTTCTCGAGAACGGCTTTAAACACAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022744.1-1272s21c1
Sequence:CCGGCAAGGAGACACACGAAGTGTTCTCGAGAACACTTCGTGTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022744.1-1299s21c1
Sequence:CCGGGCTGTTCCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022744.1-2279s21c1
Sequence:CCGGGCTTAACTCATGCCAACTCCACTCGAGTGGAGTTGGCATGAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022744.1-1710s1c1
Sequence:CCGGCAGTTGGTCTTAGGCATAGAACTCGAGTTCTATGCCTAAGACCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022744.1-1272s1c1
Sequence:CCGGCAAGGAGACACACGAAGTGTTCTCGAGAACACTTCGTGTGTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022744.1-2345s1c1
Sequence:CCGGGAGCTTGTGTTTAAAGCCGTTCTCGAGAACGGCTTTAAACACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022744.1-1299s1c1
Sequence:CCGGGCTGTTCCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022744.1-2279s1c1
Sequence:CCGGGCTTAACTCATGCCAACTCCACTCGAGTGGAGTTGGCATGAGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022744
VALIDATED
C16orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 58
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022744.1-2345s21c1
Sequence:CCGGGAGCTTGTGTTTAAAGCCGTTCTCGAGAACGGCTTTAAACACAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022744.1-1272s21c1
Sequence:CCGGCAAGGAGACACACGAAGTGTTCTCGAGAACACTTCGTGTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022744.1-1299s21c1
Sequence:CCGGGCTGTTCCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022744.1-2279s21c1
Sequence:CCGGGCTTAACTCATGCCAACTCCACTCGAGTGGAGTTGGCATGAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022744.1-1710s1c1
Sequence:CCGGCAGTTGGTCTTAGGCATAGAACTCGAGTTCTATGCCTAAGACCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022744.1-1272s1c1
Sequence:CCGGCAAGGAGACACACGAAGTGTTCTCGAGAACACTTCGTGTGTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022744.1-2345s1c1
Sequence:CCGGGAGCTTGTGTTTAAAGCCGTTCTCGAGAACGGCTTTAAACACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022744.1-1299s1c1
Sequence:CCGGGCTGTTCCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022744.1-2279s1c1
Sequence:CCGGGCTTAACTCATGCCAACTCCACTCGAGTGGAGTTGGCATGAGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022744
VALIDATED
C16orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 58
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022744.1-2345s21c1
Sequence:CCGGGAGCTTGTGTTTAAAGCCGTTCTCGAGAACGGCTTTAAACACAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022744.1-1272s21c1
Sequence:CCGGCAAGGAGACACACGAAGTGTTCTCGAGAACACTTCGTGTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022744.1-1299s21c1
Sequence:CCGGGCTGTTCCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022744.1-2279s21c1
Sequence:CCGGGCTTAACTCATGCCAACTCCACTCGAGTGGAGTTGGCATGAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022744.1-1710s1c1
Sequence:CCGGCAGTTGGTCTTAGGCATAGAACTCGAGTTCTATGCCTAAGACCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022744.1-1272s1c1
Sequence:CCGGCAAGGAGACACACGAAGTGTTCTCGAGAACACTTCGTGTGTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022744.1-2345s1c1
Sequence:CCGGGAGCTTGTGTTTAAAGCCGTTCTCGAGAACGGCTTTAAACACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022744.1-1299s1c1
Sequence:CCGGGCTGTTCCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022744.1-2279s1c1
Sequence:CCGGGCTTAACTCATGCCAACTCCACTCGAGTGGAGTTGGCATGAGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks