EMAIL THIS PAGE TO A FRIEND

C16orf59

chromosome 16 open reading frame 59

25 Gene Product Result for
UniProtKB ID: Q7L2K0, B4DXD7, Q96H61, Q9H872
Gene ID:
chicken(416750) chromosome 14 open reading frame, human C16orf59
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025108 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078301 MISSION® esiRNA esiRNA human C16orf59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025108 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028106 predicted 1308
2 SASI_Hs01_00028107 predicted 286
3 SASI_Hs01_00028108 predicted 242
4 SASI_Hs01_00028109 predicted 340
5 SASI_Hs01_00028110 predicted 295
6 SASI_Hs01_00028111 predicted 606
7 SASI_Hs02_00357809 predicted 697
8 SASI_Hs01_00028112 predicted 365
9 SASI_Hs01_00028113 predicted 904
10 SASI_Hs01_00028114 predicted 248
11 SASI_Hs01_00028115 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025108
VALIDATED
C16orf59 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 59
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-299s21c1
Sequence:CCGGGTTCGAAGAGGCATCACTAAGCTCGAGCTTAGTGATGCCTCTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025108.2-249s21c1
Sequence:CCGGACCTCAAAGAGTTGGAGTTTCCTCGAGGAAACTCCAACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025108.2-188s21c1
Sequence:CCGGCCTCCAGGGCCAGAAACTAATCTCGAGATTAGTTTCTGGCCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-1464s21c1
Sequence:CCGGGGCTCTTCTCAGGACAACTAACTCGAGTTAGTTGTCCTGAGAAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-94s21c1
Sequence:CCGGCGCACAGCGACAATTGCAATTCTCGAGAATTGCAATTGTCGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025108
VALIDATED
C16orf59 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 59
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-299s21c1
Sequence:CCGGGTTCGAAGAGGCATCACTAAGCTCGAGCTTAGTGATGCCTCTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025108.2-249s21c1
Sequence:CCGGACCTCAAAGAGTTGGAGTTTCCTCGAGGAAACTCCAACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025108.2-188s21c1
Sequence:CCGGCCTCCAGGGCCAGAAACTAATCTCGAGATTAGTTTCTGGCCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-1464s21c1
Sequence:CCGGGGCTCTTCTCAGGACAACTAACTCGAGTTAGTTGTCCTGAGAAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-94s21c1
Sequence:CCGGCGCACAGCGACAATTGCAATTCTCGAGAATTGCAATTGTCGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025108
VALIDATED
C16orf59 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 59
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-299s21c1
Sequence:CCGGGTTCGAAGAGGCATCACTAAGCTCGAGCTTAGTGATGCCTCTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025108.2-249s21c1
Sequence:CCGGACCTCAAAGAGTTGGAGTTTCCTCGAGGAAACTCCAACTCTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025108.2-188s21c1
Sequence:CCGGCCTCCAGGGCCAGAAACTAATCTCGAGATTAGTTTCTGGCCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-1464s21c1
Sequence:CCGGGGCTCTTCTCAGGACAACTAACTCGAGTTAGTTGTCCTGAGAAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_025108.2-94s21c1
Sequence:CCGGCGCACAGCGACAATTGCAATTCTCGAGAATTGCAATTGTCGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks