EMAIL THIS PAGE TO A FRIEND

C16orf62

chromosome 16 open reading frame 62

26 Gene Product Result for
Species: Human C16orf62(57020)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020314 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158161 MISSION® esiRNA esiRNA human C16orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020314 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056110 predicted 2614
2 SASI_Hs01_00056112 predicted 373
3 SASI_Hs01_00056113 predicted 503
4 SASI_Hs01_00056114 predicted 2038
5 SASI_Hs02_00353231 predicted 533
6 SASI_Hs01_00056116 predicted 2249
7 SASI_Hs01_00056117 predicted 1261
8 SASI_Hs01_00056118 predicted 1541
9 SASI_Hs02_00353232 predicted 1317
10 SASI_Hs01_00056119 predicted 2969
11 SASI_Hs01_00056111 predicted 1333
12 SASI_Hs01_00056115 predicted 883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020314
C16orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 62
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-1248s21c1
Sequence:CCGGCGAGATGATGGAAAGGTGTAACTCGAGTTACACCTTTCCATCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-616s21c1
Sequence:CCGGGACCAGAAAGTGAAGGCTCTACTCGAGTAGAGCCTTCACTTTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-2016s21c1
Sequence:CCGGGCCTGTTCTTGTGCAGTTGATCTCGAGATCAACTGCACAAGAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-1786s21c1
Sequence:CCGGGCCTTTATCAAGCATCAACAACTCGAGTTGTTGATGCTTGATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-659s1c1
Sequence:CCGGGACCAGAAAGTGAAGGCTCTACTCGAGTAGAGCCTTCACTTTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-1291s1c1
Sequence:CCGGCGAGATGATGGAAAGGTGTAACTCGAGTTACACCTTTCCATCATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020314.3-3095s1c1
Sequence:CCGGCCAGGTTATTCTGACAATGAACTCGAGTTCATTGTCAGAATAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-1829s1c1
Sequence:CCGGGCCTTTATCAAGCATCAACAACTCGAGTTGTTGATGCTTGATAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-362s1c1
Sequence:CCGGGATAGAGATGATAACTCCGTTCTCGAGAACGGAGTTATCATCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-2060s1c1
Sequence:CCGGCCTGTTCTTGTGCAGTTGATTCTCGAGAATCAACTGCACAAGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-2572s1c1
Sequence:CCGGCATAGACAAAGTGGACTCCAACTCGAGTTGGAGTCCACTTTGTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-2059s1c1
Sequence:CCGGGCCTGTTCTTGTGCAGTTGATCTCGAGATCAACTGCACAAGAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020314
C16orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 62
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-1248s21c1
Sequence:CCGGCGAGATGATGGAAAGGTGTAACTCGAGTTACACCTTTCCATCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-616s21c1
Sequence:CCGGGACCAGAAAGTGAAGGCTCTACTCGAGTAGAGCCTTCACTTTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-2016s21c1
Sequence:CCGGGCCTGTTCTTGTGCAGTTGATCTCGAGATCAACTGCACAAGAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-1786s21c1
Sequence:CCGGGCCTTTATCAAGCATCAACAACTCGAGTTGTTGATGCTTGATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-659s1c1
Sequence:CCGGGACCAGAAAGTGAAGGCTCTACTCGAGTAGAGCCTTCACTTTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-1291s1c1
Sequence:CCGGCGAGATGATGGAAAGGTGTAACTCGAGTTACACCTTTCCATCATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020314.3-3095s1c1
Sequence:CCGGCCAGGTTATTCTGACAATGAACTCGAGTTCATTGTCAGAATAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-1829s1c1
Sequence:CCGGGCCTTTATCAAGCATCAACAACTCGAGTTGTTGATGCTTGATAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-362s1c1
Sequence:CCGGGATAGAGATGATAACTCCGTTCTCGAGAACGGAGTTATCATCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-2060s1c1
Sequence:CCGGCCTGTTCTTGTGCAGTTGATTCTCGAGAATCAACTGCACAAGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-2572s1c1
Sequence:CCGGCATAGACAAAGTGGACTCCAACTCGAGTTGGAGTCCACTTTGTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-2059s1c1
Sequence:CCGGGCCTGTTCTTGTGCAGTTGATCTCGAGATCAACTGCACAAGAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020314
C16orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 62
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-1248s21c1
Sequence:CCGGCGAGATGATGGAAAGGTGTAACTCGAGTTACACCTTTCCATCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-616s21c1
Sequence:CCGGGACCAGAAAGTGAAGGCTCTACTCGAGTAGAGCCTTCACTTTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-2016s21c1
Sequence:CCGGGCCTGTTCTTGTGCAGTTGATCTCGAGATCAACTGCACAAGAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020314.4-1786s21c1
Sequence:CCGGGCCTTTATCAAGCATCAACAACTCGAGTTGTTGATGCTTGATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-659s1c1
Sequence:CCGGGACCAGAAAGTGAAGGCTCTACTCGAGTAGAGCCTTCACTTTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-1291s1c1
Sequence:CCGGCGAGATGATGGAAAGGTGTAACTCGAGTTACACCTTTCCATCATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020314.3-3095s1c1
Sequence:CCGGCCAGGTTATTCTGACAATGAACTCGAGTTCATTGTCAGAATAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-1829s1c1
Sequence:CCGGGCCTTTATCAAGCATCAACAACTCGAGTTGTTGATGCTTGATAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-362s1c1
Sequence:CCGGGATAGAGATGATAACTCCGTTCTCGAGAACGGAGTTATCATCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-2060s1c1
Sequence:CCGGCCTGTTCTTGTGCAGTTGATTCTCGAGAATCAACTGCACAAGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020314.3-2572s1c1
Sequence:CCGGCATAGACAAAGTGGACTCCAACTCGAGTTGGAGTCCACTTTGTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020314.3-2059s1c1
Sequence:CCGGGCCTGTTCTTGTGCAGTTGATCTCGAGATCAACTGCACAAGAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)