EMAIL THIS PAGE TO A FRIEND

C16orf70

chromosome 16 open reading frame 70

141 Gene Product Result for
Synonyms: C16orf6 LIN10 lin-10
Species: Human C16orf70(80262)
UniProtKB ID: Q9BSU1, Q9HA86
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025187 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051181 MISSION® esiRNA esiRNA human C16orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025187 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179240 predicted 468
2 SASI_Hs02_00357953 predicted 764
3 SASI_Hs01_00179241 predicted 1056
4 SASI_Hs01_00179242 predicted 744
5 SASI_Hs01_00179243 predicted 1309
6 SASI_Hs01_00179244 predicted 377
7 SASI_Hs01_00179245 predicted 728
8 SASI_Hs01_00179246 predicted 810
9 SASI_Hs01_00179248 predicted 1325
10 SASI_Hs01_00179249 predicted 760
11 SASI_Hs01_00179247 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025187
VALIDATED
C16orf70 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 70
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1294s1c1
Sequence:CCGGCCAACCCATTTGGTTCCACATCTCGAGATGTGGAACCAAATGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-1295s1c1
Sequence:CCGGCAACCCATTTGGTTCCACATTCTCGAGAATGTGGAACCAAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-2168s1c1
Sequence:CCGGGCCAAAGACATCTTCCTACTTCTCGAGAAGTAGGAAGATGTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1082s1c1
Sequence:CCGGGTTTGTTCTACACACCAATTACTCGAGTAATTGGTGTGTAGAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-927s1c1
Sequence:CCGGCCACACAAAGTCTTCTATAAACTCGAGTTTATAGAAGACTTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1331s1c1
Sequence:CCGGGCGAATGATCTTTGAGGTCATCTCGAGATGACCTCAAAGATCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-1044s1c1
Sequence:CCGGGACATCCTCTTTGATGCGAATCTCGAGATTCGCATCAAAGAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-849s1c1
Sequence:CCGGGATGCCAAGATGCGGGTATTTCTCGAGAAATACCCGCATCTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-602s21c1
Sequence:CCGGTCCAAAGTATGAGCCCAATTTCTCGAGAAATTGGGCTCATACTTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-990s21c1
Sequence:CCGGCAAGTTCCATCGAAGTGTAATCTCGAGATTACACTTCGATGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025187.3-1873s21c1
Sequence:CCGGTAGTACTTGGTTGCGACATTTCTCGAGAAATGTCGCAACCAAGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-720s21c1
Sequence:CCGGATGATGCCTCTGAGCTGTTTCCTCGAGGAAACAGCTCAGAGGCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-1099s21c1
Sequence:CCGGATTACCCTGGGCATTATAATTCTCGAGAATTATAATGCCCAGGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025187.3-1696s21c1
Sequence:CCGGACCCAGGAGCTCTCAACTAACCTCGAGGTTAGTTGAGAGCTCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-343s21c1
Sequence:CCGGTGACTCAGGACGGGATCAAACCTCGAGGTTTGATCCCGTCCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025187
VALIDATED
C16orf70 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 70
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1294s1c1
Sequence:CCGGCCAACCCATTTGGTTCCACATCTCGAGATGTGGAACCAAATGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-1295s1c1
Sequence:CCGGCAACCCATTTGGTTCCACATTCTCGAGAATGTGGAACCAAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-2168s1c1
Sequence:CCGGGCCAAAGACATCTTCCTACTTCTCGAGAAGTAGGAAGATGTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1082s1c1
Sequence:CCGGGTTTGTTCTACACACCAATTACTCGAGTAATTGGTGTGTAGAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-927s1c1
Sequence:CCGGCCACACAAAGTCTTCTATAAACTCGAGTTTATAGAAGACTTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1331s1c1
Sequence:CCGGGCGAATGATCTTTGAGGTCATCTCGAGATGACCTCAAAGATCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-1044s1c1
Sequence:CCGGGACATCCTCTTTGATGCGAATCTCGAGATTCGCATCAAAGAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-849s1c1
Sequence:CCGGGATGCCAAGATGCGGGTATTTCTCGAGAAATACCCGCATCTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-602s21c1
Sequence:CCGGTCCAAAGTATGAGCCCAATTTCTCGAGAAATTGGGCTCATACTTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-990s21c1
Sequence:CCGGCAAGTTCCATCGAAGTGTAATCTCGAGATTACACTTCGATGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025187.3-1873s21c1
Sequence:CCGGTAGTACTTGGTTGCGACATTTCTCGAGAAATGTCGCAACCAAGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-720s21c1
Sequence:CCGGATGATGCCTCTGAGCTGTTTCCTCGAGGAAACAGCTCAGAGGCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-1099s21c1
Sequence:CCGGATTACCCTGGGCATTATAATTCTCGAGAATTATAATGCCCAGGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025187.3-1696s21c1
Sequence:CCGGACCCAGGAGCTCTCAACTAACCTCGAGGTTAGTTGAGAGCTCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-343s21c1
Sequence:CCGGTGACTCAGGACGGGATCAAACCTCGAGGTTTGATCCCGTCCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025187
VALIDATED
C16orf70 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 70
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1294s1c1
Sequence:CCGGCCAACCCATTTGGTTCCACATCTCGAGATGTGGAACCAAATGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-1295s1c1
Sequence:CCGGCAACCCATTTGGTTCCACATTCTCGAGAATGTGGAACCAAATGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-2168s1c1
Sequence:CCGGGCCAAAGACATCTTCCTACTTCTCGAGAAGTAGGAAGATGTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1082s1c1
Sequence:CCGGGTTTGTTCTACACACCAATTACTCGAGTAATTGGTGTGTAGAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-927s1c1
Sequence:CCGGCCACACAAAGTCTTCTATAAACTCGAGTTTATAGAAGACTTTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-1331s1c1
Sequence:CCGGGCGAATGATCTTTGAGGTCATCTCGAGATGACCTCAAAGATCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025187.3-1044s1c1
Sequence:CCGGGACATCCTCTTTGATGCGAATCTCGAGATTCGCATCAAAGAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025187.3-849s1c1
Sequence:CCGGGATGCCAAGATGCGGGTATTTCTCGAGAAATACCCGCATCTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-602s21c1
Sequence:CCGGTCCAAAGTATGAGCCCAATTTCTCGAGAAATTGGGCTCATACTTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-990s21c1
Sequence:CCGGCAAGTTCCATCGAAGTGTAATCTCGAGATTACACTTCGATGGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025187.3-1873s21c1
Sequence:CCGGTAGTACTTGGTTGCGACATTTCTCGAGAAATGTCGCAACCAAGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-720s21c1
Sequence:CCGGATGATGCCTCTGAGCTGTTTCCTCGAGGAAACAGCTCAGAGGCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-1099s21c1
Sequence:CCGGATTACCCTGGGCATTATAATTCTCGAGAATTATAATGCCCAGGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025187.3-1696s21c1
Sequence:CCGGACCCAGGAGCTCTCAACTAACCTCGAGGTTAGTTGAGAGCTCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025187.3-343s21c1
Sequence:CCGGTGACTCAGGACGGGATCAAACCTCGAGGTTTGATCCCGTCCTGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks