EMAIL THIS PAGE TO A FRIEND

C16orf71

chromosome 16 open reading frame 71

Species: Human C16orf71(146562)
UniProtKB ID: Q8IYS4, Q8NCV0
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139170 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029641 MISSION® esiRNA esiRNA human C16orf71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139170 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242448 predicted 665
2 SASI_Hs01_00242449 predicted 761
3 SASI_Hs01_00242450 predicted 1252
4 SASI_Hs01_00242451 predicted 2270
5 SASI_Hs01_00242452 predicted 1856
6 SASI_Hs01_00242453 predicted 1335
7 SASI_Hs01_00242454 predicted 1934
8 SASI_Hs01_00242456 predicted 1221
9 SASI_Hs01_00242457 predicted 1378
10 SASI_Hs02_00364198 predicted 603
11 SASI_Hs01_00242455 predicted 2267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139170
C16orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 71
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.2-1074s1c1
Sequence:CCGGGAAGATGATAGAGACGGACATCTCGAGATGTCCGTCTCTATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1477s1c1
Sequence:CCGGGACACCAAAGAGGCAGATTCACTCGAGTGAATCTGCCTCTTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1481s1c1
Sequence:CCGGCCAAAGAGGCAGATTCAGGAACTCGAGTTCCTGAATCTGCCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139170.2-2066s1c1
Sequence:CCGGGCAGAGAAATCATCACCACCTCTCGAGAGGTGGTGATGATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-912s1c1
Sequence:CCGGCCTTGGAAGCCTGTCTTTCAACTCGAGTTGAAAGACAGGCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1063s1c1
Sequence:CCGGCAGGAGAGAAGGAAGATGATACTCGAGTATCATCTTCCTTCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.2-780s1c1
Sequence:CCGGCAGACAGAACACAAGGACAAACTCGAGTTTGTCCTTGTGTTCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139170.2-2067s1c1
Sequence:CCGGCAGAGAAATCATCACCACCTTCTCGAGAAGGTGGTGATGATTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1294s1c1
Sequence:CCGGCAAGAAGACAACCAGGGAAATCTCGAGATTTCCCTGGTTGTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-784s1c1
Sequence:CCGGCAGAACACAAGGACAAAGGATCTCGAGATCCTTTGTCCTTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.1-1219s1c1
Sequence:CCGGGCAACTTGAAGCGTGGGATTTCTCGAGAAATCCCACGCTTCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.1-753s1c1
Sequence:CCGGGCAGACAGAACACAAGGACAACTCGAGTTGTCCTTGTGTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139170
C16orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 71
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.2-1074s1c1
Sequence:CCGGGAAGATGATAGAGACGGACATCTCGAGATGTCCGTCTCTATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1477s1c1
Sequence:CCGGGACACCAAAGAGGCAGATTCACTCGAGTGAATCTGCCTCTTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1481s1c1
Sequence:CCGGCCAAAGAGGCAGATTCAGGAACTCGAGTTCCTGAATCTGCCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139170.2-2066s1c1
Sequence:CCGGGCAGAGAAATCATCACCACCTCTCGAGAGGTGGTGATGATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-912s1c1
Sequence:CCGGCCTTGGAAGCCTGTCTTTCAACTCGAGTTGAAAGACAGGCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1063s1c1
Sequence:CCGGCAGGAGAGAAGGAAGATGATACTCGAGTATCATCTTCCTTCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.2-780s1c1
Sequence:CCGGCAGACAGAACACAAGGACAAACTCGAGTTTGTCCTTGTGTTCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139170.2-2067s1c1
Sequence:CCGGCAGAGAAATCATCACCACCTTCTCGAGAAGGTGGTGATGATTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1294s1c1
Sequence:CCGGCAAGAAGACAACCAGGGAAATCTCGAGATTTCCCTGGTTGTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-784s1c1
Sequence:CCGGCAGAACACAAGGACAAAGGATCTCGAGATCCTTTGTCCTTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.1-1219s1c1
Sequence:CCGGGCAACTTGAAGCGTGGGATTTCTCGAGAAATCCCACGCTTCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.1-753s1c1
Sequence:CCGGGCAGACAGAACACAAGGACAACTCGAGTTGTCCTTGTGTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139170
C16orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 71
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.2-1074s1c1
Sequence:CCGGGAAGATGATAGAGACGGACATCTCGAGATGTCCGTCTCTATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1477s1c1
Sequence:CCGGGACACCAAAGAGGCAGATTCACTCGAGTGAATCTGCCTCTTTGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1481s1c1
Sequence:CCGGCCAAAGAGGCAGATTCAGGAACTCGAGTTCCTGAATCTGCCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139990    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139170.2-2066s1c1
Sequence:CCGGGCAGAGAAATCATCACCACCTCTCGAGAGGTGGTGATGATTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-912s1c1
Sequence:CCGGCCTTGGAAGCCTGTCTTTCAACTCGAGTTGAAAGACAGGCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1063s1c1
Sequence:CCGGCAGGAGAGAAGGAAGATGATACTCGAGTATCATCTTCCTTCTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.2-780s1c1
Sequence:CCGGCAGACAGAACACAAGGACAAACTCGAGTTTGTCCTTGTGTTCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139170.2-2067s1c1
Sequence:CCGGCAGAGAAATCATCACCACCTTCTCGAGAAGGTGGTGATGATTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-1294s1c1
Sequence:CCGGCAAGAAGACAACCAGGGAAATCTCGAGATTTCCCTGGTTGTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139170.2-784s1c1
Sequence:CCGGCAGAACACAAGGACAAAGGATCTCGAGATCCTTTGTCCTTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.1-1219s1c1
Sequence:CCGGGCAACTTGAAGCGTGGGATTTCTCGAGAAATCCCACGCTTCAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139170.1-753s1c1
Sequence:CCGGGCAGACAGAACACAAGGACAACTCGAGTTGTCCTTGTGTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks