EMAIL THIS PAGE TO A FRIEND

C16orf72

chromosome 16 open reading frame 72

217 Gene Product Result for
Synonyms: PRO0149
Species: Human C16orf72(29035)
UniProtKB ID: Q14CZ0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014117 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034441 MISSION® esiRNA esiRNA human C16orf72 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014117 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217243 predicted 677
2 SASI_Hs01_00217244 predicted 1227
3 SASI_Hs01_00217246 predicted 1288
4 SASI_Hs01_00217247 predicted 1277
5 SASI_Hs01_00217248 predicted 1057
6 SASI_Hs01_00217249 predicted 1101
7 SASI_Hs01_00217250 predicted 877
8 SASI_Hs02_00345124 predicted 1270
9 SASI_Hs02_00345125 predicted 1237
10 SASI_Hs01_00217251 predicted 999
11 SASI_Hs01_00217245 predicted 954
12 SASI_Hs01_00217252 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014117
VALIDATED
C16orf72 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 72
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014117.2-1035s1c1
Sequence:CCGGCGAAGGAGAAATGGACTCCATCTCGAGATGGAGTCCATTTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014117.2-1146s1c1
Sequence:CCGGGATGTCATTACAGACTCACCACTCGAGTGGTGAGTCTGTAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014117.2-2309s1c1
Sequence:CCGGGCTGTTAGGTAGACCTAAATACTCGAGTATTTAGGTCTACCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014117.2-3486s1c1
Sequence:CCGGGCTCAGCAGTAGAAGCGTAATCTCGAGATTACGCTTCTACTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014117.2-895s1c1
Sequence:CCGGGCTCATCTGTAGAGACTGATTCTCGAGAATCAGTCTCTACAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-896s21c1
Sequence:CCGGCTCATCTGTAGAGACTGATTTCTCGAGAAATCAGTCTCTACAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-720s21c1
Sequence:CCGGGGCTATCAGCGACGCAATAAGCTCGAGCTTATTGCGTCGCTGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014117.2-1156s21c1
Sequence:CCGGCAGACTCACCAACCCATAAACCTCGAGGTTTATGGGTTGGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014117.2-1232s21c1
Sequence:CCGGCCACTTGATCCTCAACATATACTCGAGTATATGTTGAGGATCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014117.2-956s21c1
Sequence:CCGGTGGTGCAATGGCTAGTATAAGCTCGAGCTTATACTAGCCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-1046s21c1
Sequence:CCGGTGGACTCCATGATGTCGATTTCTCGAGAAATCGACATCATGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014117.2-1425s21c1
Sequence:CCGGTCGTTAGCAAGATCATCATAGCTCGAGCTATGATGATCTTGCTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-652s21c1
Sequence:CCGGCCGTCACCAATCTCTACAAAGCTCGAGCTTTGTAGAGATTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014117
VALIDATED
C16orf72 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 72
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014117.2-1035s1c1
Sequence:CCGGCGAAGGAGAAATGGACTCCATCTCGAGATGGAGTCCATTTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014117.2-1146s1c1
Sequence:CCGGGATGTCATTACAGACTCACCACTCGAGTGGTGAGTCTGTAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014117.2-2309s1c1
Sequence:CCGGGCTGTTAGGTAGACCTAAATACTCGAGTATTTAGGTCTACCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014117.2-3486s1c1
Sequence:CCGGGCTCAGCAGTAGAAGCGTAATCTCGAGATTACGCTTCTACTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014117.2-895s1c1
Sequence:CCGGGCTCATCTGTAGAGACTGATTCTCGAGAATCAGTCTCTACAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-896s21c1
Sequence:CCGGCTCATCTGTAGAGACTGATTTCTCGAGAAATCAGTCTCTACAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-720s21c1
Sequence:CCGGGGCTATCAGCGACGCAATAAGCTCGAGCTTATTGCGTCGCTGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014117.2-1156s21c1
Sequence:CCGGCAGACTCACCAACCCATAAACCTCGAGGTTTATGGGTTGGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014117.2-1232s21c1
Sequence:CCGGCCACTTGATCCTCAACATATACTCGAGTATATGTTGAGGATCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014117.2-956s21c1
Sequence:CCGGTGGTGCAATGGCTAGTATAAGCTCGAGCTTATACTAGCCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-1046s21c1
Sequence:CCGGTGGACTCCATGATGTCGATTTCTCGAGAAATCGACATCATGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014117.2-1425s21c1
Sequence:CCGGTCGTTAGCAAGATCATCATAGCTCGAGCTATGATGATCTTGCTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-652s21c1
Sequence:CCGGCCGTCACCAATCTCTACAAAGCTCGAGCTTTGTAGAGATTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014117
VALIDATED
C16orf72 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 72
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014117.2-1035s1c1
Sequence:CCGGCGAAGGAGAAATGGACTCCATCTCGAGATGGAGTCCATTTCTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014117.2-1146s1c1
Sequence:CCGGGATGTCATTACAGACTCACCACTCGAGTGGTGAGTCTGTAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014117.2-2309s1c1
Sequence:CCGGGCTGTTAGGTAGACCTAAATACTCGAGTATTTAGGTCTACCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014117.2-3486s1c1
Sequence:CCGGGCTCAGCAGTAGAAGCGTAATCTCGAGATTACGCTTCTACTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014117.2-895s1c1
Sequence:CCGGGCTCATCTGTAGAGACTGATTCTCGAGAATCAGTCTCTACAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-896s21c1
Sequence:CCGGCTCATCTGTAGAGACTGATTTCTCGAGAAATCAGTCTCTACAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-720s21c1
Sequence:CCGGGGCTATCAGCGACGCAATAAGCTCGAGCTTATTGCGTCGCTGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014117.2-1156s21c1
Sequence:CCGGCAGACTCACCAACCCATAAACCTCGAGGTTTATGGGTTGGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014117.2-1232s21c1
Sequence:CCGGCCACTTGATCCTCAACATATACTCGAGTATATGTTGAGGATCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014117.2-956s21c1
Sequence:CCGGTGGTGCAATGGCTAGTATAAGCTCGAGCTTATACTAGCCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-1046s21c1
Sequence:CCGGTGGACTCCATGATGTCGATTTCTCGAGAAATCGACATCATGGAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014117.2-1425s21c1
Sequence:CCGGTCGTTAGCAAGATCATCATAGCTCGAGCTATGATGATCTTGCTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014117.2-652s21c1
Sequence:CCGGCCGTCACCAATCTCTACAAAGCTCGAGCTTTGTAGAGATTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks