EMAIL THIS PAGE TO A FRIEND

C16orf74

chromosome 16 open reading frame 74

24 Gene Product Result for
Species: Human C16orf74(404550)
UniProtKB ID: Q96GX8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049367 Anti-C16ORF74 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206967 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206967 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373675 predicted 665
2 SASI_Hs02_00373676 predicted 511
3 SASI_Hs02_00373677 predicted 669
4 SASI_Hs02_00373678 predicted 563
5 SASI_Hs02_00373679 predicted 602
6 SASI_Hs02_00373680 predicted 651
7 SASI_Hs02_00373681 predicted 598
8 SASI_Hs02_00373682 predicted 486
9 SASI_Hs02_00373683 predicted 554
10 SASI_Hs02_00373684 predicted 471
11 SASI_Hs01_00011036 predicted 364
12 SASI_Hs01_00011037 predicted 269
13 SASI_Hs01_00011038 predicted 420
14 SASI_Hs01_00011039 predicted 314
15 SASI_Hs01_00011040 predicted 280
16 SASI_Hs01_00011041 predicted 370
17 SASI_Hs01_00011042 predicted 389
18 SASI_Hs01_00011043 predicted 273
19 SASI_Hs01_00011044 predicted 275
20 SASI_Hs01_00011045 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206967
C16orf74 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 74
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206967.2-481s21c1
Sequence:CCGGCTGGAGCAGGTGTGCTGAATACTCGAGTATTCAGCACACCTGCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-317s21c1
Sequence:CCGGCATGATGCTGCCGAGGGACTTCTCGAGAAGTCCCTCGGCAGCATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-369s21c1
Sequence:CCGGTCGTGCCCAGATGATGGAGAACTCGAGTTCTCCATCATCTGGGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-205s21c1
Sequence:CCGGGCTTTCAAATGTGTGTCAGCACTCGAGTGCTGACACACATTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206967
C16orf74 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 74
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206967.2-481s21c1
Sequence:CCGGCTGGAGCAGGTGTGCTGAATACTCGAGTATTCAGCACACCTGCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-317s21c1
Sequence:CCGGCATGATGCTGCCGAGGGACTTCTCGAGAAGTCCCTCGGCAGCATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-369s21c1
Sequence:CCGGTCGTGCCCAGATGATGGAGAACTCGAGTTCTCCATCATCTGGGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-205s21c1
Sequence:CCGGGCTTTCAAATGTGTGTCAGCACTCGAGTGCTGACACACATTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206967
C16orf74 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 74
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206967.2-481s21c1
Sequence:CCGGCTGGAGCAGGTGTGCTGAATACTCGAGTATTCAGCACACCTGCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-317s21c1
Sequence:CCGGCATGATGCTGCCGAGGGACTTCTCGAGAAGTCCCTCGGCAGCATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-369s21c1
Sequence:CCGGTCGTGCCCAGATGATGGAGAACTCGAGTTCTCCATCATCTGGGCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206967.2-205s21c1
Sequence:CCGGGCTTTCAAATGTGTGTCAGCACTCGAGTGCTGACACACATTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)