EMAIL THIS PAGE TO A FRIEND

C16orf78

chromosome 16 open reading frame 78

20 Gene Product Result for
Species: Human C16orf78(123970)
UniProtKB ID: Q8WTQ4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144602 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048021 MISSION® esiRNA esiRNA human C16orf78 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144602 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364403 predicted 629
2 SASI_Hs01_00216693 predicted 356
3 SASI_Hs01_00216694 predicted 564
4 SASI_Hs01_00216695 predicted 348
5 SASI_Hs01_00216696 predicted 352
6 SASI_Hs01_00216698 predicted 519
7 SASI_Hs02_00364404 predicted 387
8 SASI_Hs01_00216699 predicted 487
9 SASI_Hs01_00216701 predicted 201
10 SASI_Hs01_00216702 predicted 689
11 SASI_Hs01_00216697 predicted 596
12 SASI_Hs01_00216700 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144602
C16orf78 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 78
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-633s1c1
Sequence:CCGGGCACCGAACCTAAGATGGAAACTCGAGTTTCCATCTTAGGTTCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-175s1c1
Sequence:CCGGGAAGAAACAAGCTCCCGAGAACTCGAGTTCTCGGGAGCTTGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-691s1c1
Sequence:CCGGCCGATACCTGAGGTTATCCAACTCGAGTTGGATAACCTCAGGTATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-493s1c1
Sequence:CCGGCCGTCGACAAAGCATTGTCTTCTCGAGAAGACAATGCTTTGTCGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-709s1c1
Sequence:CCGGCAAGGAGAACATTCGGACCTTCTCGAGAAGGTCCGAATGTTCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-426s1c1
Sequence:CCGGCCAAGAAATCTGATACAGACACTCGAGTGTCTGTATCAGATTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-562s1c1
Sequence:CCGGCATAAGAGACTGGTCCAACAACTCGAGTTGTTGGACCAGTCTCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-79s1c1
Sequence:CCGGGCCCACAAAGAGGAAATACATCTCGAGATGTATTTCCTCTTTGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-636s1c1
Sequence:CCGGCCGAACCTAAGATGGAAACCACTCGAGTGGTTTCCATCTTAGGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144602
C16orf78 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 78
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-633s1c1
Sequence:CCGGGCACCGAACCTAAGATGGAAACTCGAGTTTCCATCTTAGGTTCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-175s1c1
Sequence:CCGGGAAGAAACAAGCTCCCGAGAACTCGAGTTCTCGGGAGCTTGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-691s1c1
Sequence:CCGGCCGATACCTGAGGTTATCCAACTCGAGTTGGATAACCTCAGGTATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-493s1c1
Sequence:CCGGCCGTCGACAAAGCATTGTCTTCTCGAGAAGACAATGCTTTGTCGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-709s1c1
Sequence:CCGGCAAGGAGAACATTCGGACCTTCTCGAGAAGGTCCGAATGTTCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-426s1c1
Sequence:CCGGCCAAGAAATCTGATACAGACACTCGAGTGTCTGTATCAGATTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-562s1c1
Sequence:CCGGCATAAGAGACTGGTCCAACAACTCGAGTTGTTGGACCAGTCTCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-79s1c1
Sequence:CCGGGCCCACAAAGAGGAAATACATCTCGAGATGTATTTCCTCTTTGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-636s1c1
Sequence:CCGGCCGAACCTAAGATGGAAACCACTCGAGTGGTTTCCATCTTAGGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144602
C16orf78 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 78
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-633s1c1
Sequence:CCGGGCACCGAACCTAAGATGGAAACTCGAGTTTCCATCTTAGGTTCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-175s1c1
Sequence:CCGGGAAGAAACAAGCTCCCGAGAACTCGAGTTCTCGGGAGCTTGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-691s1c1
Sequence:CCGGCCGATACCTGAGGTTATCCAACTCGAGTTGGATAACCTCAGGTATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-493s1c1
Sequence:CCGGCCGTCGACAAAGCATTGTCTTCTCGAGAAGACAATGCTTTGTCGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-709s1c1
Sequence:CCGGCAAGGAGAACATTCGGACCTTCTCGAGAAGGTCCGAATGTTCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-426s1c1
Sequence:CCGGCCAAGAAATCTGATACAGACACTCGAGTGTCTGTATCAGATTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-562s1c1
Sequence:CCGGCATAAGAGACTGGTCCAACAACTCGAGTTGTTGGACCAGTCTCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144602.2-79s1c1
Sequence:CCGGGCCCACAAAGAGGAAATACATCTCGAGATGTATTTCCTCTTTGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144602.2-636s1c1
Sequence:CCGGCCGAACCTAAGATGGAAACCACTCGAGTGGTTTCCATCTTAGGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)