EMAIL THIS PAGE TO A FRIEND

C16orf80

chromosome 16 open reading frame 80

53 Gene Product Result for
Synonyms: EVORF GTL3 fSAP23
Species: Human C16orf80(29105)
UniProtKB ID: Q9Y6A4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100258 Anti-C16ORF80 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, zebrafish, rat, horse, canine, human, mouse, bovine
western blot pricing
SAB2102998 Anti-C16ORF80 antibody produced in rabbit affinity isolated antibody rabbit, rat, canine, zebrafish, bovine, human, mouse, guinea pig, horse
western blot pricing
HPA018195 Anti-CFAP20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV34301 Anti-GTL3 antibody produced in rabbit affinity isolated antibody bovine, rat, mouse, human, guinea pig, horse, canine, zebrafish, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013242 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009111 MISSION® esiRNA esiRNA targeting human C16orf80 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013242 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050652 predicted 1018
2 SASI_Hs01_00050653 predicted 430
3 SASI_Hs01_00050654 predicted 908
4 SASI_Hs01_00050655 predicted 651
5 SASI_Hs01_00050656 predicted 1001
6 SASI_Hs01_00050657 predicted 414
7 SASI_Hs01_00050658 predicted 667
8 SASI_Hs01_00050659 predicted 696
9 SASI_Hs01_00050660 predicted 882
10 SASI_Hs02_00344446 predicted 831
11 SASI_Hs01_00050661 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013242
VALIDATED
C16orf80 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 80
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-668s1c1
Sequence:CCGGCAGATTCAGTTCAACTTGCTACTCGAGTAGCAAGTTGAACTGAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-415s1c1
Sequence:CCGGGCTAGAGATTGAAGGGACAAACTCGAGTTTGTCCCTTCAATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-338s1c1
Sequence:CCGGCCTCTGCAAATCTGGGACAAACTCGAGTTTGTCCCAGATTTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013242.2-481s1c1
Sequence:CCGGGCTGGGAATTAAACTTCCTTTCTCGAGAAAGGAAGTTTAATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-809s21c1
Sequence:CCGGCCGGCAGAGTTCAAACTGTATCTCGAGATACAGTTTGAACTCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-1077s21c1
Sequence:CCGGCATGAACGCTGGAGCTTATTCCTCGAGGAATAAGCTCCAGCGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013242.2-700s21c1
Sequence:CCGGGCGAGCATACGGCACCAATTACTCGAGTAATTGGTGCCGTATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-754s21c1
Sequence:CCGGTTGTCGCATCCGACGGGTTTACTCGAGTAAACCCGTCGGATGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013242.2-552s21c1
Sequence:CCGGAGGTACTAGATGACAAGAATGCTCGAGCATTCTTGTCATCTAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013242
VALIDATED
C16orf80 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 80
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-668s1c1
Sequence:CCGGCAGATTCAGTTCAACTTGCTACTCGAGTAGCAAGTTGAACTGAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-415s1c1
Sequence:CCGGGCTAGAGATTGAAGGGACAAACTCGAGTTTGTCCCTTCAATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-338s1c1
Sequence:CCGGCCTCTGCAAATCTGGGACAAACTCGAGTTTGTCCCAGATTTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013242.2-481s1c1
Sequence:CCGGGCTGGGAATTAAACTTCCTTTCTCGAGAAAGGAAGTTTAATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-809s21c1
Sequence:CCGGCCGGCAGAGTTCAAACTGTATCTCGAGATACAGTTTGAACTCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-1077s21c1
Sequence:CCGGCATGAACGCTGGAGCTTATTCCTCGAGGAATAAGCTCCAGCGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013242.2-700s21c1
Sequence:CCGGGCGAGCATACGGCACCAATTACTCGAGTAATTGGTGCCGTATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-754s21c1
Sequence:CCGGTTGTCGCATCCGACGGGTTTACTCGAGTAAACCCGTCGGATGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013242.2-552s21c1
Sequence:CCGGAGGTACTAGATGACAAGAATGCTCGAGCATTCTTGTCATCTAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013242
VALIDATED
C16orf80 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 80
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-668s1c1
Sequence:CCGGCAGATTCAGTTCAACTTGCTACTCGAGTAGCAAGTTGAACTGAATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-415s1c1
Sequence:CCGGGCTAGAGATTGAAGGGACAAACTCGAGTTTGTCCCTTCAATCTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013242.2-338s1c1
Sequence:CCGGCCTCTGCAAATCTGGGACAAACTCGAGTTTGTCCCAGATTTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013242.2-481s1c1
Sequence:CCGGGCTGGGAATTAAACTTCCTTTCTCGAGAAAGGAAGTTTAATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-809s21c1
Sequence:CCGGCCGGCAGAGTTCAAACTGTATCTCGAGATACAGTTTGAACTCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-1077s21c1
Sequence:CCGGCATGAACGCTGGAGCTTATTCCTCGAGGAATAAGCTCCAGCGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013242.2-700s21c1
Sequence:CCGGGCGAGCATACGGCACCAATTACTCGAGTAATTGGTGCCGTATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013242.2-754s21c1
Sequence:CCGGTTGTCGCATCCGACGGGTTTACTCGAGTAAACCCGTCGGATGCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013242.2-552s21c1
Sequence:CCGGAGGTACTAGATGACAAGAATGCTCGAGCATTCTTGTCATCTAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks