EMAIL THIS PAGE TO A FRIEND

C16orf82

chromosome 16 open reading frame 82

80 Gene Product Result for
Synonyms: TNT
Species: Human C16orf82(162083)
UniProtKB ID: Q7Z2V1, B9EGC2, Q8NEF0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182831 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219551 MISSION® esiRNA esiRNA targeting human C16orf82 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182831 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068295 predicted 1189
2 SASI_Hs01_00068296 predicted 606
3 SASI_Hs01_00068297 predicted 848
4 SASI_Hs01_00068298 predicted 1183
5 SASI_Hs01_00068299 predicted 360
6 SASI_Hs01_00068300 predicted 1181
7 SASI_Hs01_00068301 predicted 217
8 SASI_Hs01_00068302 predicted 209
9 SASI_Hs01_00068303 predicted 681
10 SASI_Hs01_00068304 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182831
C16orf82 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 82
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-289s1c1
Sequence:CCGGCCTGGATAAACCACTTCAGCTCTCGAGAGCTGAAGTGGTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1560s1c1
Sequence:CCGGCCATGATGAAACCATCCTAAACTCGAGTTTAGGATGGTTTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1193s1c1
Sequence:CCGGCCCATTTGTAGCAACAAGCATCTCGAGATGCTTGTTGCTACAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-218s1c1
Sequence:CCGGCTTATATACGGAGTCACCTCTCTCGAGAGAGGTGACTCCGTATATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-213s1c1
Sequence:CCGGGCAGCCTTATATACGGAGTCACTCGAGTGACTCCGTATATAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-341s1c1
Sequence:CCGGGAATCCTCTGTCCAGAATGAGCTCGAGCTCATTCTGGACAGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1546s1c1
Sequence:CCGGCGAGTTAGAACCTTCCATGATCTCGAGATCATGGAAGGTTCTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-2123s1c1
Sequence:CCGGCCATCCTGTGTTCAGATGGTTCTCGAGAACCATCTGAACACAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-185s1c1
Sequence:CCGGGCCACTCAGAACACAGAGTTTCTCGAGAAACTCTGTGTTCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182831
C16orf82 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 82
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-289s1c1
Sequence:CCGGCCTGGATAAACCACTTCAGCTCTCGAGAGCTGAAGTGGTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1560s1c1
Sequence:CCGGCCATGATGAAACCATCCTAAACTCGAGTTTAGGATGGTTTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1193s1c1
Sequence:CCGGCCCATTTGTAGCAACAAGCATCTCGAGATGCTTGTTGCTACAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-218s1c1
Sequence:CCGGCTTATATACGGAGTCACCTCTCTCGAGAGAGGTGACTCCGTATATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-213s1c1
Sequence:CCGGGCAGCCTTATATACGGAGTCACTCGAGTGACTCCGTATATAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-341s1c1
Sequence:CCGGGAATCCTCTGTCCAGAATGAGCTCGAGCTCATTCTGGACAGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1546s1c1
Sequence:CCGGCGAGTTAGAACCTTCCATGATCTCGAGATCATGGAAGGTTCTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-2123s1c1
Sequence:CCGGCCATCCTGTGTTCAGATGGTTCTCGAGAACCATCTGAACACAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-185s1c1
Sequence:CCGGGCCACTCAGAACACAGAGTTTCTCGAGAAACTCTGTGTTCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182831
C16orf82 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 82
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-289s1c1
Sequence:CCGGCCTGGATAAACCACTTCAGCTCTCGAGAGCTGAAGTGGTTTATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1560s1c1
Sequence:CCGGCCATGATGAAACCATCCTAAACTCGAGTTTAGGATGGTTTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1193s1c1
Sequence:CCGGCCCATTTGTAGCAACAAGCATCTCGAGATGCTTGTTGCTACAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-218s1c1
Sequence:CCGGCTTATATACGGAGTCACCTCTCTCGAGAGAGGTGACTCCGTATATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-213s1c1
Sequence:CCGGGCAGCCTTATATACGGAGTCACTCGAGTGACTCCGTATATAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-341s1c1
Sequence:CCGGGAATCCTCTGTCCAGAATGAGCTCGAGCTCATTCTGGACAGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-1546s1c1
Sequence:CCGGCGAGTTAGAACCTTCCATGATCTCGAGATCATGGAAGGTTCTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182831.1-2123s1c1
Sequence:CCGGCCATCCTGTGTTCAGATGGTTCTCGAGAACCATCTGAACACAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182831.1-185s1c1
Sequence:CCGGGCCACTCAGAACACAGAGTTTCTCGAGAAACTCTGTGTTCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks