EMAIL THIS PAGE TO A FRIEND

C16orf86

chromosome 16 open reading frame 86

Species: Human C16orf86(388284)
UniProtKB ID: Q6ZW13, B5MCW6
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012984 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026671 MISSION® esiRNA esiRNA human C16orf86 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012984 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306290 predicted 669
2 SASI_Hs01_00208981 predicted 672
3 SASI_Hs02_00306291 predicted 672
4 SASI_Hs01_00208982 predicted 726
5 SASI_Hs02_00306292 predicted 467
6 SASI_Hs02_00306293 predicted 589
7 SASI_Hs02_00306294 predicted 465
8 SASI_Hs01_00208988 predicted 999
9 SASI_Hs02_00306295 predicted 728
10 SASI_Hs01_00208989 predicted 1022
11 SASI_Hs01_00208980 predicted 596
12 SASI_Hs01_00208983 predicted 1110
13 SASI_Hs01_00208984 predicted 935
14 SASI_Hs01_00208985 predicted 537
15 SASI_Hs01_00208986 predicted 531
16 SASI_Hs01_00208987 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012984
C16orf86 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 86
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-695s21c1
Sequence:CCGGACATTGAGGCTGGAGCGAAAGCTCGAGCTTTCGCTCCAGCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-1011s21c1
Sequence:CCGGACAAGGCCGAGGTGGATAAGTCTCGAGACTTATCCACCTCGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-735s21c1
Sequence:CCGGTGTACCAGTACGTCAACTATTCTCGAGAATAGTTGACGTACTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-673s21c1
Sequence:CCGGCATGGTGTCTGCACCCTTAGACTCGAGTCTAAGGGTGCAGACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-1089s21c1
Sequence:CCGGCGCTCTCTCCTCAGTACAAGTCTCGAGACTTGTACTGAGGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012984
C16orf86 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 86
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-695s21c1
Sequence:CCGGACATTGAGGCTGGAGCGAAAGCTCGAGCTTTCGCTCCAGCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-1011s21c1
Sequence:CCGGACAAGGCCGAGGTGGATAAGTCTCGAGACTTATCCACCTCGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-735s21c1
Sequence:CCGGTGTACCAGTACGTCAACTATTCTCGAGAATAGTTGACGTACTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-673s21c1
Sequence:CCGGCATGGTGTCTGCACCCTTAGACTCGAGTCTAAGGGTGCAGACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-1089s21c1
Sequence:CCGGCGCTCTCTCCTCAGTACAAGTCTCGAGACTTGTACTGAGGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012984
C16orf86 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 86
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-695s21c1
Sequence:CCGGACATTGAGGCTGGAGCGAAAGCTCGAGCTTTCGCTCCAGCCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-1011s21c1
Sequence:CCGGACAAGGCCGAGGTGGATAAGTCTCGAGACTTATCCACCTCGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-735s21c1
Sequence:CCGGTGTACCAGTACGTCAACTATTCTCGAGAATAGTTGACGTACTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-673s21c1
Sequence:CCGGCATGGTGTCTGCACCCTTAGACTCGAGTCTAAGGGTGCAGACACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012984.2-1089s21c1
Sequence:CCGGCGCTCTCTCCTCAGTACAAGTCTCGAGACTTGTACTGAGGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks