EMAIL THIS PAGE TO A FRIEND

C16orf87

chromosome 16 open reading frame 87

20 Gene Product Result for
Species: Human C16orf87(388272)
UniProtKB ID: Q6PH81, Q63HN9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_370981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370981 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009891 MISSION® esiRNA esiRNA targeting human C16orf87 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001436 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065020 predicted 466
2 SASI_Hs01_00065021 predicted 493
3 SASI_Hs01_00065023 predicted 201
4 SASI_Hs01_00065024 predicted 373
5 SASI_Hs01_00065025 predicted 456
6 SASI_Hs01_00065026 predicted 383
7 SASI_Hs02_00303774 predicted 286
8 SASI_Hs01_00065027 predicted 461
9 SASI_Hs01_00065028 predicted 490
10 SASI_Hs01_00065029 predicted 378
11 SASI_Hs01_00065022 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370981
C16orf87 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 87
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-305s1c1
Sequence:CCGGCGAGGAAGAGGAAGACCTAAACTCGAGTTTAGGTCTTCCTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-291s1c1
Sequence:CCGGCAGATCATATCAGACGAGGAACTCGAGTTCCTCGTCTGATATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-350s1c1
Sequence:CCGGGAAGAAAGAGAGAAACAGGAACTCGAGTTCCTGTTTCTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-99s1c1
Sequence:CCGGCATGTCCTTGTGGTTACATATCTCGAGATATGTAACCACAAGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-93s1c1
Sequence:CCGGGTAAATCATGTCCTTGTGGTTCTCGAGAACCACAAGGACATGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-279s1c1
Sequence:CCGGGTAACAGCCATTCAGATCATACTCGAGTATGATCTGAATGGCTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370981.1-556s1c1
Sequence:CCGGGCATTCTGACTGCATCAATAACTCGAGTTATTGATGCAGTCAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370981.1-755s1c1
Sequence:CCGGGCTGGATGGATGTTAAAGGATCTCGAGATCCTTTAACATCCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-211s1c1
Sequence:CCGGGAGAGTTAGGAGAGAGAAGATCTCGAGATCTTCTCTCTCCTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-275s1c1
Sequence:CCGGCGAAGTAACAGCCATTCAGATCTCGAGATCTGAATGGCTGTTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-262s1c1
Sequence:CCGGCAGAAAGAGGTCTCGAAGTAACTCGAGTTACTTCGAGACCTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370981
C16orf87 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 87
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-305s1c1
Sequence:CCGGCGAGGAAGAGGAAGACCTAAACTCGAGTTTAGGTCTTCCTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-291s1c1
Sequence:CCGGCAGATCATATCAGACGAGGAACTCGAGTTCCTCGTCTGATATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-350s1c1
Sequence:CCGGGAAGAAAGAGAGAAACAGGAACTCGAGTTCCTGTTTCTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-99s1c1
Sequence:CCGGCATGTCCTTGTGGTTACATATCTCGAGATATGTAACCACAAGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-93s1c1
Sequence:CCGGGTAAATCATGTCCTTGTGGTTCTCGAGAACCACAAGGACATGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-279s1c1
Sequence:CCGGGTAACAGCCATTCAGATCATACTCGAGTATGATCTGAATGGCTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370981.1-556s1c1
Sequence:CCGGGCATTCTGACTGCATCAATAACTCGAGTTATTGATGCAGTCAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370981.1-755s1c1
Sequence:CCGGGCTGGATGGATGTTAAAGGATCTCGAGATCCTTTAACATCCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-211s1c1
Sequence:CCGGGAGAGTTAGGAGAGAGAAGATCTCGAGATCTTCTCTCTCCTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-275s1c1
Sequence:CCGGCGAAGTAACAGCCATTCAGATCTCGAGATCTGAATGGCTGTTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-262s1c1
Sequence:CCGGCAGAAAGAGGTCTCGAAGTAACTCGAGTTACTTCGAGACCTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370981
C16orf87 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 87
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-305s1c1
Sequence:CCGGCGAGGAAGAGGAAGACCTAAACTCGAGTTTAGGTCTTCCTCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-291s1c1
Sequence:CCGGCAGATCATATCAGACGAGGAACTCGAGTTCCTCGTCTGATATGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-350s1c1
Sequence:CCGGGAAGAAAGAGAGAAACAGGAACTCGAGTTCCTGTTTCTCTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-99s1c1
Sequence:CCGGCATGTCCTTGTGGTTACATATCTCGAGATATGTAACCACAAGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-93s1c1
Sequence:CCGGGTAAATCATGTCCTTGTGGTTCTCGAGAACCACAAGGACATGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-279s1c1
Sequence:CCGGGTAACAGCCATTCAGATCATACTCGAGTATGATCTGAATGGCTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370981.1-556s1c1
Sequence:CCGGGCATTCTGACTGCATCAATAACTCGAGTTATTGATGCAGTCAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370981.1-755s1c1
Sequence:CCGGGCTGGATGGATGTTAAAGGATCTCGAGATCCTTTAACATCCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-211s1c1
Sequence:CCGGGAGAGTTAGGAGAGAGAAGATCTCGAGATCTTCTCTCTCCTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370981.1-275s1c1
Sequence:CCGGCGAAGTAACAGCCATTCAGATCTCGAGATCTGAATGGCTGTTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370981.1-262s1c1
Sequence:CCGGCAGAAAGAGGTCTCGAAGTAACTCGAGTTACTTCGAGACCTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks