EMAIL THIS PAGE TO A FRIEND

C16orf89

chromosome 16 open reading frame 89

Species: Human C16orf89(146556)
UniProtKB ID: Q6UX73, B4DUM5, Q8N2I3, Q8N4T1
Gene ID:
Human(146556) Summary: This gene is expressed predominantly in the thyroid. Based on expression patterns similar to thyroid transcription factors and proteins, this gene may function in the development and function of the thyroid. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070311 MISSION® esiRNA esiRNA human C16orf89 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098514 Rosetta Predictions human pricing
NM_152459 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319197 predicted 843
2 SASI_Hs02_00319198 predicted 653
3 SASI_Hs02_00319199 predicted 269
4 SASI_Hs02_00319200 predicted 902
5 SASI_Hs02_00319201 predicted 700
6 SASI_Hs02_00319202 predicted 513
7 SASI_Hs02_00319203 predicted 778
8 SASI_Hs02_00319204 predicted 612
9 SASI_Hs02_00319205 predicted 739
10 SASI_Hs02_00319206 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152140 predicted 851
2 SASI_Hs02_00366233 predicted 656
3 SASI_Hs02_00366234 predicted 269
4 SASI_Hs01_00152142 predicted 909
5 SASI_Hs01_00152144 predicted 692
6 SASI_Hs01_00152147 predicted 522
7 SASI_Hs01_00152148 predicted 779
8 SASI_Hs02_00366235 predicted 617
9 SASI_Hs02_00366236 predicted 733
10 SASI_Hs02_00366237 predicted 278
11 SASI_Hs01_00152139 predicted 825
12 SASI_Hs01_00152141 predicted 711
13 SASI_Hs01_00152143 predicted 464
14 SASI_Hs01_00152145 predicted 1599
15 SASI_Hs01_00152146 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152459
C16orf89 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 89
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-723s1c1
Sequence:CCGGCCAGGACTATATCAACCTCTTCTCGAGAAGAGGTTGATATAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-148s1c1
Sequence:CCGGGCTGAAAGTAAAGCCACCATTCTCGAGAATGGTGGCTTTACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152459.2-1525s1c1
Sequence:CCGGCCTATACATCCTGGCAGAATACTCGAGTATTCTGCCAGGATGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-1054s1c1
Sequence:CCGGGCTATTCAATATCAGCAGCATCTCGAGATGCTGCTGATATTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-1181s1c1
Sequence:CCGGCTGGGTTCAAGCAATTCTCTTCTCGAGAAGAGAATTGCTTGAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152459.3-1691s21c1
Sequence:CCGGTTTAGTCCTCATCCCTTAGATCTCGAGATCTAAGGGATGAGGACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152459.3-1072s21c1
Sequence:CCGGTGCTGAAGATGAAGAATTATCCTCGAGGATAATTCTTCATCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152459.3-1445s21c1
Sequence:CCGGTCAATGAGACTGTGTTGAATACTCGAGTATTCAACACAGTCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152459
C16orf89 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 89
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-723s1c1
Sequence:CCGGCCAGGACTATATCAACCTCTTCTCGAGAAGAGGTTGATATAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-148s1c1
Sequence:CCGGGCTGAAAGTAAAGCCACCATTCTCGAGAATGGTGGCTTTACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152459.2-1525s1c1
Sequence:CCGGCCTATACATCCTGGCAGAATACTCGAGTATTCTGCCAGGATGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-1054s1c1
Sequence:CCGGGCTATTCAATATCAGCAGCATCTCGAGATGCTGCTGATATTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-1181s1c1
Sequence:CCGGCTGGGTTCAAGCAATTCTCTTCTCGAGAAGAGAATTGCTTGAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152459.3-1691s21c1
Sequence:CCGGTTTAGTCCTCATCCCTTAGATCTCGAGATCTAAGGGATGAGGACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152459.3-1072s21c1
Sequence:CCGGTGCTGAAGATGAAGAATTATCCTCGAGGATAATTCTTCATCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152459.3-1445s21c1
Sequence:CCGGTCAATGAGACTGTGTTGAATACTCGAGTATTCAACACAGTCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152459
C16orf89 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 89
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-723s1c1
Sequence:CCGGCCAGGACTATATCAACCTCTTCTCGAGAAGAGGTTGATATAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-148s1c1
Sequence:CCGGGCTGAAAGTAAAGCCACCATTCTCGAGAATGGTGGCTTTACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152459.2-1525s1c1
Sequence:CCGGCCTATACATCCTGGCAGAATACTCGAGTATTCTGCCAGGATGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-1054s1c1
Sequence:CCGGGCTATTCAATATCAGCAGCATCTCGAGATGCTGCTGATATTGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152459.2-1181s1c1
Sequence:CCGGCTGGGTTCAAGCAATTCTCTTCTCGAGAAGAGAATTGCTTGAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152459.3-1691s21c1
Sequence:CCGGTTTAGTCCTCATCCCTTAGATCTCGAGATCTAAGGGATGAGGACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152459.3-1072s21c1
Sequence:CCGGTGCTGAAGATGAAGAATTATCCTCGAGGATAATTCTTCATCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152459.3-1445s21c1
Sequence:CCGGTCAATGAGACTGTGTTGAATACTCGAGTATTCAACACAGTCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks