EMAIL THIS PAGE TO A FRIEND

C16orf90

chromosome 16 open reading frame 90

23 Gene Product Result for
Species: Human C16orf90(646174)
UniProtKB ID: A8MZG2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080524 Rosetta Predictions human pricing
XM_929133 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315677 predicted 218
2 SASI_Hs02_00315678 predicted 339
3 SASI_Hs02_00315679 predicted 216
4 SASI_Hs02_00315680 predicted 219
5 SASI_Hs02_00315681 predicted 449
6 SASI_Hs02_00315682 predicted 450
7 SASI_Hs02_00315683 predicted 383
8 SASI_Hs02_00315684 predicted 328
9 SASI_Hs02_00315685 predicted 440
10 SASI_Hs02_00315686 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299338 predicted 224
2 SASI_Hs01_00299339 predicted 219
3 SASI_Hs01_00299340 predicted 222
4 SASI_Hs01_00299341 predicted 272
5 SASI_Hs01_00299342 predicted 220
6 SASI_Hs01_00299343 predicted 327
7 SASI_Hs01_00299344 predicted 222
8 SASI_Hs01_00299345 predicted 244
9 SASI_Hs01_00299346 predicted 500
10 SASI_Hs01_00299347 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080524
C16orf90 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 90
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-334s21c1
Sequence:CCGGCCACGTAACAGCCTCTGTTCACTCGAGTGAACAGAGGCTGTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-26s21c1
Sequence:CCGGCTGAGCTGCACATAAGAGAAGCTCGAGCTTCTCTTATGTGCAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-497s21c1
Sequence:CCGGCCATGTGTCCCTTGTGCAAGACTCGAGTCTTGCACAAGGGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-408s21c1
Sequence:CCGGTTCCAGCATGGACCCAGACAACTCGAGTTGTCTGGGTCCATGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-149s21c1
Sequence:CCGGAGGGAAGCAAGCCCAAGAACTCTCGAGAGTTCTTGGGCTTGCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080524
C16orf90 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 90
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-334s21c1
Sequence:CCGGCCACGTAACAGCCTCTGTTCACTCGAGTGAACAGAGGCTGTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-26s21c1
Sequence:CCGGCTGAGCTGCACATAAGAGAAGCTCGAGCTTCTCTTATGTGCAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-497s21c1
Sequence:CCGGCCATGTGTCCCTTGTGCAAGACTCGAGTCTTGCACAAGGGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-408s21c1
Sequence:CCGGTTCCAGCATGGACCCAGACAACTCGAGTTGTCTGGGTCCATGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-149s21c1
Sequence:CCGGAGGGAAGCAAGCCCAAGAACTCTCGAGAGTTCTTGGGCTTGCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080524
C16orf90 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 90
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-334s21c1
Sequence:CCGGCCACGTAACAGCCTCTGTTCACTCGAGTGAACAGAGGCTGTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-26s21c1
Sequence:CCGGCTGAGCTGCACATAAGAGAAGCTCGAGCTTCTCTTATGTGCAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-497s21c1
Sequence:CCGGCCATGTGTCCCTTGTGCAAGACTCGAGTCTTGCACAAGGGACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-408s21c1
Sequence:CCGGTTCCAGCATGGACCCAGACAACTCGAGTTGTCTGGGTCCATGCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080524.1-149s21c1
Sequence:CCGGAGGGAAGCAAGCCCAAGAACTCTCGAGAGTTCTTGGGCTTGCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks