EMAIL THIS PAGE TO A FRIEND

C16orf91

chromosome 16 open reading frame 91

Synonyms: CCSMST1 gs103
Species: Human C16orf91(283951)
Gene ID:
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_370925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370925 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159641 MISSION® esiRNA esiRNA human C16orf91 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010878 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191126 predicted 315
2 SASI_Hs01_00191127 predicted 845
3 SASI_Hs01_00191129 predicted 473
4 SASI_Hs01_00191130 predicted 815
5 SASI_Hs01_00191131 predicted 730
6 SASI_Hs01_00191132 predicted 661
7 SASI_Hs02_00305834 predicted 714
8 SASI_Hs01_00191134 predicted 743
9 SASI_Hs01_00191135 predicted 665
10 SASI_Hs02_00305835 predicted 681
11 SASI_Hs01_00191128 predicted 321
12 SASI_Hs01_00191133 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370925
C16orf91 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 91
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-114s1c1
Sequence:CCGGGAAAGGGACGGAGAACTACATCTCGAGATGTAGTTCTCCGTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-32s1c1
Sequence:CCGGCAGACAACTCTCTGAGGACAACTCGAGTTGTCCTCAGAGAGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370925.2-924s1c1
Sequence:CCGGGCCAAGTCTTTGTATAACATACTCGAGTATGTTATACAAAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-239s1c1
Sequence:CCGGCAGCAATGAATCGTGTCTTGTCTCGAGACAAGACACGATTCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-241s1c2
Sequence:CCGGGCAATGAATCGTGTCTTGTGTCTCGAGACACAAGACACGATTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-124s1c1
Sequence:CCGGGAGAACTACATTTCCCGGCATCTCGAGATGCCGGGAAATGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-234s1c1
Sequence:CCGGCAAGGCAGCAATGAATCGTGTCTCGAGACACGATTCATTGCTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370925
C16orf91 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 91
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-114s1c1
Sequence:CCGGGAAAGGGACGGAGAACTACATCTCGAGATGTAGTTCTCCGTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-32s1c1
Sequence:CCGGCAGACAACTCTCTGAGGACAACTCGAGTTGTCCTCAGAGAGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370925.2-924s1c1
Sequence:CCGGGCCAAGTCTTTGTATAACATACTCGAGTATGTTATACAAAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-239s1c1
Sequence:CCGGCAGCAATGAATCGTGTCTTGTCTCGAGACAAGACACGATTCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-241s1c2
Sequence:CCGGGCAATGAATCGTGTCTTGTGTCTCGAGACACAAGACACGATTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-124s1c1
Sequence:CCGGGAGAACTACATTTCCCGGCATCTCGAGATGCCGGGAAATGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-234s1c1
Sequence:CCGGCAAGGCAGCAATGAATCGTGTCTCGAGACACGATTCATTGCTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370925
C16orf91 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 91
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-114s1c1
Sequence:CCGGGAAAGGGACGGAGAACTACATCTCGAGATGTAGTTCTCCGTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-32s1c1
Sequence:CCGGCAGACAACTCTCTGAGGACAACTCGAGTTGTCCTCAGAGAGTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370925.2-924s1c1
Sequence:CCGGGCCAAGTCTTTGTATAACATACTCGAGTATGTTATACAAAGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-239s1c1
Sequence:CCGGCAGCAATGAATCGTGTCTTGTCTCGAGACAAGACACGATTCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-241s1c2
Sequence:CCGGGCAATGAATCGTGTCTTGTGTCTCGAGACACAAGACACGATTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-124s1c1
Sequence:CCGGGAGAACTACATTTCCCGGCATCTCGAGATGCCGGGAAATGTAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_370925.2-234s1c1
Sequence:CCGGCAAGGCAGCAATGAATCGTGTCTCGAGACACGATTCATTGCTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks