EMAIL THIS PAGE TO A FRIEND

C16orf93

chromosome 16 open reading frame 93

19 Gene Product Result for
Species: Human C16orf93(90835)
UniProtKB ID: A1A4V9, A1A4V8, F5GX13, Q569G2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014979 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056201 MISSION® esiRNA esiRNA human AC106886.3-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014979 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069132 predicted 1413
2 SASI_Hs01_00069133 predicted 1404
3 SASI_Hs01_00069134 predicted 1337
4 SASI_Hs01_00069135 predicted 1007
5 SASI_Hs01_00069136 predicted 1323
6 SASI_Hs01_00069137 predicted 1480
7 SASI_Hs01_00069138 predicted 1065
8 SASI_Hs01_00069139 predicted 1446
9 SASI_Hs01_00069140 predicted 1007
10 SASI_Hs01_00069141 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014979
C16orf93 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 93
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1339s21c1
Sequence:CCGGTCAGCATCGACCTCTTCAAAGCTCGAGCTTTGAAGAGGTCGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1236s21c1
Sequence:CCGGGATCTTCACAAGGCTTGTATTCTCGAGAATACAAGCCTTGTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1452s21c1
Sequence:CCGGCTGGATCTGTCTTTGACTTACCTCGAGGTAAGTCAAAGACAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1408s21c1
Sequence:CCGGGCCACTTCAAGCTCTATAAATCTCGAGATTTATAGAGCTTGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1716s21c1
Sequence:CCCGAGCAAGTTGACTGCACTAGAGCTCGAGCTCTAGTGCAGTCAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1628s1c1
Sequence:CCGGCTACATCAAGACCCAAGTGAACTCGAGTTCACTTGGGTCTTGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1013s1c1
Sequence:CCGGGATCTGCATGTGGAAGTACCTCTCGAGAGGTACTTCCACATGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1061s1c1
Sequence:CCGGGAAGACCACCAATGCTGAGATCTCGAGATCTCAGCATTGGTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1558s1c1
Sequence:CCGGCGCAGAAAGAGGAACTAGAGACTCGAGTCTCTAGTTCCTCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1640s1c1
Sequence:CCGGCCAAGTGAACAAAGAGCTGGACTCGAGTCCAGCTCTTTGTTCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014979
C16orf93 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 93
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1339s21c1
Sequence:CCGGTCAGCATCGACCTCTTCAAAGCTCGAGCTTTGAAGAGGTCGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1236s21c1
Sequence:CCGGGATCTTCACAAGGCTTGTATTCTCGAGAATACAAGCCTTGTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1452s21c1
Sequence:CCGGCTGGATCTGTCTTTGACTTACCTCGAGGTAAGTCAAAGACAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1408s21c1
Sequence:CCGGGCCACTTCAAGCTCTATAAATCTCGAGATTTATAGAGCTTGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1716s21c1
Sequence:CCCGAGCAAGTTGACTGCACTAGAGCTCGAGCTCTAGTGCAGTCAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1628s1c1
Sequence:CCGGCTACATCAAGACCCAAGTGAACTCGAGTTCACTTGGGTCTTGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1013s1c1
Sequence:CCGGGATCTGCATGTGGAAGTACCTCTCGAGAGGTACTTCCACATGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1061s1c1
Sequence:CCGGGAAGACCACCAATGCTGAGATCTCGAGATCTCAGCATTGGTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1558s1c1
Sequence:CCGGCGCAGAAAGAGGAACTAGAGACTCGAGTCTCTAGTTCCTCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1640s1c1
Sequence:CCGGCCAAGTGAACAAAGAGCTGGACTCGAGTCCAGCTCTTTGTTCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014979
C16orf93 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 93
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1339s21c1
Sequence:CCGGTCAGCATCGACCTCTTCAAAGCTCGAGCTTTGAAGAGGTCGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1236s21c1
Sequence:CCGGGATCTTCACAAGGCTTGTATTCTCGAGAATACAAGCCTTGTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1452s21c1
Sequence:CCGGCTGGATCTGTCTTTGACTTACCTCGAGGTAAGTCAAAGACAGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1408s21c1
Sequence:CCGGGCCACTTCAAGCTCTATAAATCTCGAGATTTATAGAGCTTGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014979.1-1716s21c1
Sequence:CCCGAGCAAGTTGACTGCACTAGAGCTCGAGCTCTAGTGCAGTCAACTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1628s1c1
Sequence:CCGGCTACATCAAGACCCAAGTGAACTCGAGTTCACTTGGGTCTTGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1013s1c1
Sequence:CCGGGATCTGCATGTGGAAGTACCTCTCGAGAGGTACTTCCACATGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1061s1c1
Sequence:CCGGGAAGACCACCAATGCTGAGATCTCGAGATCTCAGCATTGGTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1558s1c1
Sequence:CCGGCGCAGAAAGAGGAACTAGAGACTCGAGTCTCTAGTTCCTCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014979.1-1640s1c1
Sequence:CCGGCCAAGTGAACAAAGAGCTGGACTCGAGTCCAGCTCTTTGTTCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks