EMAIL THIS PAGE TO A FRIEND

C16orf96

chromosome 16 open reading frame 96

Species: Human C16orf96(342346)
UniProtKB ID: A6NNT2, C9JH24
Gene ID:
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145011 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715874 Rosetta Predictions human pricing
XM_296817 Rosetta Predictions human pricing
XM_940260 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00406683 predicted 2425
2 SASI_Hs02_00406684 predicted 1893
3 SASI_Hs02_00406685 predicted 2356
4 SASI_Hs02_00406686 predicted 2332
5 SASI_Hs02_00406687 predicted 401
6 SASI_Hs02_00406688 predicted 2454
7 SASI_Hs02_00406689 predicted 530
8 SASI_Hs02_00406690 predicted 505
9 SASI_Hs02_00406691 predicted 684
10 SASI_Hs02_00406692 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_296817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479211 predicted 1790
2 SASI_Hs02_00479212 predicted 606
3 SASI_Hs02_00479213 predicted 472
4 SASI_Hs02_00479214 predicted 430
5 SASI_Hs01_00249906 predicted 399
6 SASI_Hs02_00479215 predicted 433
7 SASI_Hs01_00249909 predicted 523
8 SASI_Hs02_00479216 predicted 513
9 SASI_Hs02_00479217 predicted 383
10 SASI_Hs02_00479218 predicted 502
11 SASI_Hs01_00249901 predicted 1337
12 SASI_Hs01_00249902 predicted 1763
13 SASI_Hs01_00249903 predicted 2218
14 SASI_Hs01_00249904 predicted 2208
15 SASI_Hs01_00249905 predicted 541
16 SASI_Hs01_00249907 predicted 2212
17 SASI_Hs01_00249908 predicted 2325
18 SASI_Hs01_00249910 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484118 predicted 2420
2 SASI_Hs02_00484119 predicted 1892
3 SASI_Hs02_00484120 predicted 2353
4 SASI_Hs02_00484121 predicted 2339
5 SASI_Hs02_00484122 predicted 401
6 SASI_Hs02_00484123 predicted 2448
7 SASI_Hs02_00484124 predicted 527
8 SASI_Hs02_00484125 predicted 507
9 SASI_Hs02_00484126 predicted 686
10 SASI_Hs02_00484127 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145011
C16orf96 MISSION shRNA Bacterial Glycerol Stock
chromosome 16 open reading frame 96
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2131s21c1
Sequence:CCGGCTGAACCAGCGCTTGAGTTATCTCGAGATAACTCAAGCGCTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2972s21c1
Sequence:CCGGGCAACCTGTTGACGCTCTATCCTCGAGGATAGAGCGTCAACAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-1350s21c1
Sequence:CCGGGCTCGCAGCTGTCCAAGTAAACTCGAGTTTACTTGGACAGCTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-3172s21c1
Sequence:CCGGGTGCACTCCAGTGCCCTATTTCTCGAGAAATAGGGCACTGGAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2180s21c1
Sequence:CCGGTCGGGACAACAGTGGACATATCTCGAGATATGTCCACTGTTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2349s21c1
Sequence:CCGGCAAGACTCTCCAGGCTCAAATCTCGAGATTTGAGCCTGGAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-830s21c1
Sequence:CCGGTGCAGACTGTCTGGCATTATGCTCGAGCATAATGCCAGACAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145011
C16orf96 MISSION shRNA shRNA Plasmid DNA
chromosome 16 open reading frame 96
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2131s21c1
Sequence:CCGGCTGAACCAGCGCTTGAGTTATCTCGAGATAACTCAAGCGCTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2972s21c1
Sequence:CCGGGCAACCTGTTGACGCTCTATCCTCGAGGATAGAGCGTCAACAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-1350s21c1
Sequence:CCGGGCTCGCAGCTGTCCAAGTAAACTCGAGTTTACTTGGACAGCTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-3172s21c1
Sequence:CCGGGTGCACTCCAGTGCCCTATTTCTCGAGAAATAGGGCACTGGAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2180s21c1
Sequence:CCGGTCGGGACAACAGTGGACATATCTCGAGATATGTCCACTGTTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2349s21c1
Sequence:CCGGCAAGACTCTCCAGGCTCAAATCTCGAGATTTGAGCCTGGAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-830s21c1
Sequence:CCGGTGCAGACTGTCTGGCATTATGCTCGAGCATAATGCCAGACAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145011
C16orf96 MISSION shRNA Lentiviral Transduction Particles
chromosome 16 open reading frame 96
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2131s21c1
Sequence:CCGGCTGAACCAGCGCTTGAGTTATCTCGAGATAACTCAAGCGCTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2972s21c1
Sequence:CCGGGCAACCTGTTGACGCTCTATCCTCGAGGATAGAGCGTCAACAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-1350s21c1
Sequence:CCGGGCTCGCAGCTGTCCAAGTAAACTCGAGTTTACTTGGACAGCTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-3172s21c1
Sequence:CCGGGTGCACTCCAGTGCCCTATTTCTCGAGAAATAGGGCACTGGAGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2180s21c1
Sequence:CCGGTCGGGACAACAGTGGACATATCTCGAGATATGTCCACTGTTGTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-2349s21c1
Sequence:CCGGCAAGACTCTCCAGGCTCAAATCTCGAGATTTGAGCCTGGAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145011.1-830s21c1
Sequence:CCGGTGCAGACTGTCTGGCATTATGCTCGAGCATAATGCCAGACAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks