EMAIL THIS PAGE TO A FRIEND

C17orf100

chromosome 17 open reading frame 100

Species: Human C17orf100(388327)
UniProtKB ID: A8MU93
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU232311 MISSION® esiRNA esiRNA targeting human C17orf100 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324179 predicted 671
2 SASI_Hs02_00324180 predicted 954
3 SASI_Hs02_00324181 predicted 425
4 SASI_Hs02_00324182 predicted 647
5 SASI_Hs02_00324183 predicted 954
6 SASI_Hs02_00324184 predicted 964
7 SASI_Hs02_00324185 predicted 641
8 SASI_Hs02_00324186 predicted 886
9 SASI_Hs02_00324187 predicted 974
10 SASI_Hs02_00324188 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105520
C17orf100 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 100
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-643s21c1
Sequence:CCGGTCATGGAAACAAACCATAAATCTCGAGATTTATGGTTTGTTTCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-1361s21c1
Sequence:CCGGACATGCTCAGAACACCTAAAGCTCGAGCTTTAGGTGTTCTGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-692s21c1
Sequence:CCGGTCTGAACACAGCCAACGTTTACTCGAGTAAACGTTGGCTGTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-616s21c1
Sequence:CCGGTGCCAGGTGGACCAATCATTTCTCGAGAAATGATTGGTCCACCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-1257s21c1
Sequence:CCGGTTACCTCCCGTTGAAACTATTCTCGAGAATAGTTTCAACGGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105520
C17orf100 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 100
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-643s21c1
Sequence:CCGGTCATGGAAACAAACCATAAATCTCGAGATTTATGGTTTGTTTCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-1361s21c1
Sequence:CCGGACATGCTCAGAACACCTAAAGCTCGAGCTTTAGGTGTTCTGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-692s21c1
Sequence:CCGGTCTGAACACAGCCAACGTTTACTCGAGTAAACGTTGGCTGTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-616s21c1
Sequence:CCGGTGCCAGGTGGACCAATCATTTCTCGAGAAATGATTGGTCCACCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-1257s21c1
Sequence:CCGGTTACCTCCCGTTGAAACTATTCTCGAGAATAGTTTCAACGGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105520
C17orf100 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 100
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-643s21c1
Sequence:CCGGTCATGGAAACAAACCATAAATCTCGAGATTTATGGTTTGTTTCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-1361s21c1
Sequence:CCGGACATGCTCAGAACACCTAAAGCTCGAGCTTTAGGTGTTCTGAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-692s21c1
Sequence:CCGGTCTGAACACAGCCAACGTTTACTCGAGTAAACGTTGGCTGTGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-616s21c1
Sequence:CCGGTGCCAGGTGGACCAATCATTTCTCGAGAAATGATTGGTCCACCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105520.1-1257s21c1
Sequence:CCGGTTACCTCCCGTTGAAACTATTCTCGAGAATAGTTTCAACGGGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks