EMAIL THIS PAGE TO A FRIEND

C17orf102

chromosome 17 open reading frame 102

78 Gene Product Result for
Species: Human C17orf102(400591)
UniProtKB ID: A2RUQ5, A5PKX0, Q6ZTB3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043259 Anti-C17orf102 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375436 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029281 MISSION® esiRNA esiRNA human AC005691.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207454 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096374 predicted 805
2 SASI_Hs01_00096375 predicted 998
3 SASI_Hs01_00096376 predicted 983
4 SASI_Hs01_00096377 predicted 858
5 SASI_Hs02_00374088 predicted 975
6 SASI_Hs01_00096382 predicted 1013
7 SASI_Hs02_00374089 predicted 1019
8 SASI_Hs01_00096379 predicted 481
9 SASI_Hs01_00096380 predicted 782
10 SASI_Hs01_00096381 predicted 428
11 SASI_Hs01_00096378 predicted 203
12 SASI_Hs01_00096383 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207454
C17orf102 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 102
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207454.2-481s21c1
Sequence:CCGGGGACAGTGCTTTCCTACAGTACTCGAGTACTGTAGGAAAGCACTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207454.2-705s21c1
Sequence:CCGGGGGAGCAGCCTGCTATCTTTACTCGAGTAAAGATAGCAGGCTGCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207454.2-885s21c1
Sequence:CCGGATAGCCCACCTGGAGAATAAACTCGAGTTTATTCTCCAGGTGGGCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207454.2-206s21c1
Sequence:CCGGCGCAGTCACTGATGTCCCTTTCTCGAGAAAGGGACATCAGTGACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207454.1-1747s1c1
Sequence:CCGGGCTCTAATTGTGTGTGAAGTACTCGAGTACTTCACACACAATTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207454
C17orf102 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 102
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207454.2-481s21c1
Sequence:CCGGGGACAGTGCTTTCCTACAGTACTCGAGTACTGTAGGAAAGCACTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207454.2-705s21c1
Sequence:CCGGGGGAGCAGCCTGCTATCTTTACTCGAGTAAAGATAGCAGGCTGCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207454.2-885s21c1
Sequence:CCGGATAGCCCACCTGGAGAATAAACTCGAGTTTATTCTCCAGGTGGGCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207454.2-206s21c1
Sequence:CCGGCGCAGTCACTGATGTCCCTTTCTCGAGAAAGGGACATCAGTGACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207454.1-1747s1c1
Sequence:CCGGGCTCTAATTGTGTGTGAAGTACTCGAGTACTTCACACACAATTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207454
C17orf102 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 102
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207454.2-481s21c1
Sequence:CCGGGGACAGTGCTTTCCTACAGTACTCGAGTACTGTAGGAAAGCACTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207454.2-705s21c1
Sequence:CCGGGGGAGCAGCCTGCTATCTTTACTCGAGTAAAGATAGCAGGCTGCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207454.2-885s21c1
Sequence:CCGGATAGCCCACCTGGAGAATAAACTCGAGTTTATTCTCCAGGTGGGCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207454.2-206s21c1
Sequence:CCGGCGCAGTCACTGATGTCCCTTTCTCGAGAAAGGGACATCAGTGACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207454.1-1747s1c1
Sequence:CCGGGCTCTAATTGTGTGTGAAGTACTCGAGTACTTCACACACAATTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375436
C17orf102 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 102
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000137606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-517s1c1
Sequence:CCGGCCAACATCACAGGCATTGTAGCTCGAGCTACAATGCCTGTGATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-572s1c1
Sequence:CCGGCCTCATGGAACTAACTTTCTACTCGAGTAGAAAGTTAGTTCCATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-494s1c1
Sequence:CCGGCTACAGTAGTATGGTGCATATCTCGAGATATGCACCATACTACTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-502s1c1
Sequence:CCGGGTATGGTGCATATCTCCAACACTCGAGTGTTGGAGATATGCACCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375436
C17orf102 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 102
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000137606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-517s1c1
Sequence:CCGGCCAACATCACAGGCATTGTAGCTCGAGCTACAATGCCTGTGATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-572s1c1
Sequence:CCGGCCTCATGGAACTAACTTTCTACTCGAGTAGAAAGTTAGTTCCATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-494s1c1
Sequence:CCGGCTACAGTAGTATGGTGCATATCTCGAGATATGCACCATACTACTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-502s1c1
Sequence:CCGGGTATGGTGCATATCTCCAACACTCGAGTGTTGGAGATATGCACCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375436
C17orf102 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 102
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000137606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-517s1c1
Sequence:CCGGCCAACATCACAGGCATTGTAGCTCGAGCTACAATGCCTGTGATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-572s1c1
Sequence:CCGGCCTCATGGAACTAACTTTCTACTCGAGTAGAAAGTTAGTTCCATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-494s1c1
Sequence:CCGGCTACAGTAGTATGGTGCATATCTCGAGATATGCACCATACTACTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375436.1-502s1c1
Sequence:CCGGGTATGGTGCATATCTCCAACACTCGAGTGTTGGAGATATGCACCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)