EMAIL THIS PAGE TO A FRIEND

C17orf103

chromosome 17 open reading frame 103

28 Gene Product Result for
Synonyms: Gtlf3b
Species: Human C17orf103(256302)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152914 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152914 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076652 predicted 427
2 SASI_Hs02_00366889 predicted 744
3 SASI_Hs01_00076658 predicted 259
4 SASI_Hs02_00366890 predicted 427
5 SASI_Hs02_00366891 predicted 712
6 SASI_Hs01_00076661 predicted 369
7 SASI_Hs02_00366892 predicted 520
8 SASI_Hs02_00366893 predicted 271
9 SASI_Hs02_00366894 predicted 543
10 SASI_Hs02_00366895 predicted 331
11 SASI_Hs01_00076653 predicted 512
12 SASI_Hs01_00076654 predicted 475
13 SASI_Hs01_00076655 predicted 417
14 SASI_Hs01_00076656 predicted 569
15 SASI_Hs01_00076657 predicted 686
16 SASI_Hs01_00076659 predicted 411
17 SASI_Hs01_00076660 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152914
VALIDATED
C17orf103 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 103
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152914.1-422s1c1
Sequence:CCGGCTGGTACATCCAGAAGTACGTCTCGAGACGTACTTCTGGATGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-435s21c1
Sequence:CCGGGGAACAGACTCAGAGTTATTTCTCGAGAAATAACTCTGAGTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-86s21c1
Sequence:CCGGCCAGTTCACTGTCCGGCTCAACTCGAGTTGAGCCGGACAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-289s21c1
Sequence:CCGGAGAAGTACGTCAAGGAGAACCCTCGAGGGTTCTCCTTGACGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-126s21c1
Sequence:CCGGGTCCTGCTCTATGAGTACGTGCTCGAGCACGTACTCATAGAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152914.2-206s21c1
Sequence:CCGGCATCGCCAAGCACCTTGCCAACTCGAGTTGGCAAGGTGCTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-267s21c1
Sequence:CCGGCATCTCACCTGCTGGTACATCCTCGAGGATGTACCAGCAGGTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152914.2-4186s21c1
Sequence:CCGGTCCCGGGACATGCCCATTATTCTCGAGAATAATGGGCATGTCCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-96s21c1
Sequence:CCGGGTCCGGCTCAACGGATGTCATCTCGAGATGACATCCGTTGAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-281s21c1
Sequence:CCGGGTACATCCAGAAGTACGTCAACTCGAGTTGACGTACTTCTGGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152914
VALIDATED
C17orf103 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 103
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152914.1-422s1c1
Sequence:CCGGCTGGTACATCCAGAAGTACGTCTCGAGACGTACTTCTGGATGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-435s21c1
Sequence:CCGGGGAACAGACTCAGAGTTATTTCTCGAGAAATAACTCTGAGTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-86s21c1
Sequence:CCGGCCAGTTCACTGTCCGGCTCAACTCGAGTTGAGCCGGACAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-289s21c1
Sequence:CCGGAGAAGTACGTCAAGGAGAACCCTCGAGGGTTCTCCTTGACGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-126s21c1
Sequence:CCGGGTCCTGCTCTATGAGTACGTGCTCGAGCACGTACTCATAGAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152914.2-206s21c1
Sequence:CCGGCATCGCCAAGCACCTTGCCAACTCGAGTTGGCAAGGTGCTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-267s21c1
Sequence:CCGGCATCTCACCTGCTGGTACATCCTCGAGGATGTACCAGCAGGTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152914.2-4186s21c1
Sequence:CCGGTCCCGGGACATGCCCATTATTCTCGAGAATAATGGGCATGTCCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-96s21c1
Sequence:CCGGGTCCGGCTCAACGGATGTCATCTCGAGATGACATCCGTTGAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-281s21c1
Sequence:CCGGGTACATCCAGAAGTACGTCAACTCGAGTTGACGTACTTCTGGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152914
VALIDATED
C17orf103 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 103
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152914.1-422s1c1
Sequence:CCGGCTGGTACATCCAGAAGTACGTCTCGAGACGTACTTCTGGATGTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-435s21c1
Sequence:CCGGGGAACAGACTCAGAGTTATTTCTCGAGAAATAACTCTGAGTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-86s21c1
Sequence:CCGGCCAGTTCACTGTCCGGCTCAACTCGAGTTGAGCCGGACAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-289s21c1
Sequence:CCGGAGAAGTACGTCAAGGAGAACCCTCGAGGGTTCTCCTTGACGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-126s21c1
Sequence:CCGGGTCCTGCTCTATGAGTACGTGCTCGAGCACGTACTCATAGAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152914.2-206s21c1
Sequence:CCGGCATCGCCAAGCACCTTGCCAACTCGAGTTGGCAAGGTGCTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-267s21c1
Sequence:CCGGCATCTCACCTGCTGGTACATCCTCGAGGATGTACCAGCAGGTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152914.2-4186s21c1
Sequence:CCGGTCCCGGGACATGCCCATTATTCTCGAGAATAATGGGCATGTCCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-96s21c1
Sequence:CCGGGTCCGGCTCAACGGATGTCATCTCGAGATGACATCCGTTGAGCCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_152914.2-281s21c1
Sequence:CCGGGTACATCCAGAAGTACGTCAACTCGAGTTGACGTACTTCTGGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks