EMAIL THIS PAGE TO A FRIEND

C17orf104

chromosome 17 open reading frame 104

68 Gene Product Result for
Species: Human C17orf104(284071)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033659 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218109 predicted 2082
2 SASI_Hs01_00218110 predicted 639
3 SASI_Hs01_00218111 predicted 2045
4 SASI_Hs01_00218112 predicted 908
5 SASI_Hs01_00218113 predicted 897
6 SASI_Hs01_00218114 predicted 1702
7 SASI_Hs01_00218115 predicted 1302
8 SASI_Hs01_00218116 predicted 1811
9 SASI_Hs01_00218117 predicted 733
10 SASI_Hs01_00218118 predicted 1953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033659
VALIDATED
C17orf104 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 104
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2194s1c1
Sequence:CCGGGCTGTGAACAATGGAGAGCATCTCGAGATGCTCTCCATTGTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-727s1c1
Sequence:CCGGCCCAAACTGGTCTGTCTGATACTCGAGTATCAGACAGACCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033659.1-2698s1c1
Sequence:CCGGGCGAGACTCTATCTCAATAAACTCGAGTTTATTGAGATAGAGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2334s1c1
Sequence:CCGGCGCTTAATTGTGGATGAACTTCTCGAGAAGTTCATCCACAATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033659.1-760s1c1
Sequence:CCGGCAGGAGTTGATATCTACCATTCTCGAGAATGGTAGATATCAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033659.1-897s1c1
Sequence:CCGGCCAGAGTATGTTCATCCTAATCTCGAGATTAGGATGAACATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033659.1-2361s1c1
Sequence:CCGGCTAGCCAGAGTAAGCTGTAAACTCGAGTTTACAGCTTACTCTGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2160s1c1
Sequence:CCGGCCAGCCAGTGAACTTCATATTCTCGAGAATATGAAGTTCACTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001033659.1-2003s1c1
Sequence:CCGGCCATTCAGTTGTTCCACTGTTCTCGAGAACAGTGGAACAACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033659
VALIDATED
C17orf104 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 104
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2194s1c1
Sequence:CCGGGCTGTGAACAATGGAGAGCATCTCGAGATGCTCTCCATTGTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-727s1c1
Sequence:CCGGCCCAAACTGGTCTGTCTGATACTCGAGTATCAGACAGACCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033659.1-2698s1c1
Sequence:CCGGGCGAGACTCTATCTCAATAAACTCGAGTTTATTGAGATAGAGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2334s1c1
Sequence:CCGGCGCTTAATTGTGGATGAACTTCTCGAGAAGTTCATCCACAATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033659.1-760s1c1
Sequence:CCGGCAGGAGTTGATATCTACCATTCTCGAGAATGGTAGATATCAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033659.1-897s1c1
Sequence:CCGGCCAGAGTATGTTCATCCTAATCTCGAGATTAGGATGAACATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033659.1-2361s1c1
Sequence:CCGGCTAGCCAGAGTAAGCTGTAAACTCGAGTTTACAGCTTACTCTGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2160s1c1
Sequence:CCGGCCAGCCAGTGAACTTCATATTCTCGAGAATATGAAGTTCACTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001033659.1-2003s1c1
Sequence:CCGGCCATTCAGTTGTTCCACTGTTCTCGAGAACAGTGGAACAACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033659
VALIDATED
C17orf104 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 104
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2194s1c1
Sequence:CCGGGCTGTGAACAATGGAGAGCATCTCGAGATGCTCTCCATTGTTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-727s1c1
Sequence:CCGGCCCAAACTGGTCTGTCTGATACTCGAGTATCAGACAGACCAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033659.1-2698s1c1
Sequence:CCGGGCGAGACTCTATCTCAATAAACTCGAGTTTATTGAGATAGAGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2334s1c1
Sequence:CCGGCGCTTAATTGTGGATGAACTTCTCGAGAAGTTCATCCACAATTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033659.1-760s1c1
Sequence:CCGGCAGGAGTTGATATCTACCATTCTCGAGAATGGTAGATATCAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033659.1-897s1c1
Sequence:CCGGCCAGAGTATGTTCATCCTAATCTCGAGATTAGGATGAACATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033659.1-2361s1c1
Sequence:CCGGCTAGCCAGAGTAAGCTGTAAACTCGAGTTTACAGCTTACTCTGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001033659.1-2160s1c1
Sequence:CCGGCCAGCCAGTGAACTTCATATTCTCGAGAATATGAAGTTCACTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001033659.1-2003s1c1
Sequence:CCGGCCATTCAGTTGTTCCACTGTTCTCGAGAACAGTGGAACAACTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks