EMAIL THIS PAGE TO A FRIEND

C17orf105

chromosome 17 open reading frame 105

38 Gene Product Result for
Species: Human C17orf105(284067)
UniProtKB ID: B2RV13
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136483 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001722064 Rosetta Predictions human pricing
XM_208990 Rosetta Predictions human pricing
XM_937761 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446872 predicted 305
2 SASI_Hs02_00446873 predicted 473
3 SASI_Hs02_00446874 predicted 362
4 SASI_Hs02_00446875 predicted 459
5 SASI_Hs02_00446876 predicted 405
6 SASI_Hs02_00446877 predicted 212
7 SASI_Hs02_00446878 predicted 448
8 SASI_Hs02_00446879 predicted 437
9 SASI_Hs02_00446880 predicted 492
10 SASI_Hs02_00446881 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478943 predicted 301
2 SASI_Hs01_00275237 predicted 468
3 SASI_Hs01_00275238 predicted 365
4 SASI_Hs01_00275239 predicted 456
5 SASI_Hs01_00275240 predicted 404
6 SASI_Hs01_00275241 predicted 203
7 SASI_Hs02_00478944 predicted 442
8 SASI_Hs02_00478945 predicted 432
9 SASI_Hs01_00275243 predicted 488
10 SASI_Hs01_00275244 predicted 358
11 SASI_Hs01_00275236 predicted 257
12 SASI_Hs01_00275242 predicted 292
13 SASI_Hs01_00275245 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482729 predicted 304
2 SASI_Hs02_00482730 predicted 473
3 SASI_Hs02_00482731 predicted 362
4 SASI_Hs02_00482732 predicted 453
5 SASI_Hs02_00482733 predicted 399
6 SASI_Hs02_00482734 predicted 210
7 SASI_Hs02_00482735 predicted 447
8 SASI_Hs02_00482736 predicted 439
9 SASI_Hs02_00482737 predicted 490
10 SASI_Hs02_00482738 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136483
C17orf105 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 105
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-56s21c1
Sequence:CCGGTACCCTGTTATCGTCTCTAATCTCGAGATTAGAGACGATAACAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-482s21c1
Sequence:CCGGATCAGAAATACCACGAGATATCTCGAGATATCTCGTGGTATTTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-120s21c1
Sequence:CCGGACTACGTATCTCACAAGAATACTCGAGTATTCTTGTGAGATACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-183s21c1
Sequence:CCGGTGGCGCACACAAATCACATTTCTCGAGAAATGTGATTTGTGTGCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136483.1-627s21c1
Sequence:CCGGTCAATAAAGCTTGGAACATAACTCGAGTTATGTTCCAAGCTTTATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136483
C17orf105 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 105
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-56s21c1
Sequence:CCGGTACCCTGTTATCGTCTCTAATCTCGAGATTAGAGACGATAACAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-482s21c1
Sequence:CCGGATCAGAAATACCACGAGATATCTCGAGATATCTCGTGGTATTTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-120s21c1
Sequence:CCGGACTACGTATCTCACAAGAATACTCGAGTATTCTTGTGAGATACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-183s21c1
Sequence:CCGGTGGCGCACACAAATCACATTTCTCGAGAAATGTGATTTGTGTGCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136483.1-627s21c1
Sequence:CCGGTCAATAAAGCTTGGAACATAACTCGAGTTATGTTCCAAGCTTTATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136483
C17orf105 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 105
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-56s21c1
Sequence:CCGGTACCCTGTTATCGTCTCTAATCTCGAGATTAGAGACGATAACAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-482s21c1
Sequence:CCGGATCAGAAATACCACGAGATATCTCGAGATATCTCGTGGTATTTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-120s21c1
Sequence:CCGGACTACGTATCTCACAAGAATACTCGAGTATTCTTGTGAGATACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136483.1-183s21c1
Sequence:CCGGTGGCGCACACAAATCACATTTCTCGAGAAATGTGATTTGTGTGCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136483.1-627s21c1
Sequence:CCGGTCAATAAAGCTTGGAACATAACTCGAGTTATGTTCCAAGCTTTATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)