EMAIL THIS PAGE TO A FRIEND

C17orf47

chromosome 17 open reading frame 47

30 Gene Product Result for
Species: Human C17orf47(284083)
UniProtKB ID: Q8NEP4, Q8N821
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001038704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001038704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001038704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175904 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102181 MISSION® esiRNA esiRNA human C17orf47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038704 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072351 predicted 1667
2 SASI_Hs01_00072353 predicted 1040
3 SASI_Hs01_00072354 predicted 1244
4 SASI_Hs02_00308407 predicted 1842
5 SASI_Hs02_00308408 predicted 1532
6 SASI_Hs01_00072357 predicted 1311
7 SASI_Hs01_00072358 predicted 1808
8 SASI_Hs02_00308409 predicted 1607
9 SASI_Hs02_00308410 predicted 1537
10 SASI_Hs02_00308411 predicted 1378
11 SASI_Hs01_00072350 predicted 747
12 SASI_Hs01_00072352 predicted 767
13 SASI_Hs01_00072355 predicted 761
14 SASI_Hs01_00072356 predicted 776
15 SASI_Hs01_00072359 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001038704
C17orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 47
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-885s21c1
Sequence:CCGGCAGGTCCTTACGGTCCAATTCCTCGAGGAATTGGACCGTAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-188s21c1
Sequence:CCGGGGGTCTGAGGTTACTACTAACCTCGAGGTTAGTAGTAACCTCAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-1831s21c1
Sequence:CCGGTGGGTCGTTTAGGAGATAAATCTCGAGATTTATCTCCTAAACGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-979s21c1
Sequence:CCGGTGATGGTGTACACCGAGTTTCCTCGAGGAAACTCGGTGTACACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038704.1-1901s21c1
Sequence:CCGGATTTCACCATTAGAGTCATTTCTCGAGAAATGACTCTAATGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001038704
C17orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 47
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-885s21c1
Sequence:CCGGCAGGTCCTTACGGTCCAATTCCTCGAGGAATTGGACCGTAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-188s21c1
Sequence:CCGGGGGTCTGAGGTTACTACTAACCTCGAGGTTAGTAGTAACCTCAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-1831s21c1
Sequence:CCGGTGGGTCGTTTAGGAGATAAATCTCGAGATTTATCTCCTAAACGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-979s21c1
Sequence:CCGGTGATGGTGTACACCGAGTTTCCTCGAGGAAACTCGGTGTACACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038704.1-1901s21c1
Sequence:CCGGATTTCACCATTAGAGTCATTTCTCGAGAAATGACTCTAATGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001038704
C17orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 47
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-885s21c1
Sequence:CCGGCAGGTCCTTACGGTCCAATTCCTCGAGGAATTGGACCGTAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-188s21c1
Sequence:CCGGGGGTCTGAGGTTACTACTAACCTCGAGGTTAGTAGTAACCTCAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-1831s21c1
Sequence:CCGGTGGGTCGTTTAGGAGATAAATCTCGAGATTTATCTCCTAAACGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038704.1-979s21c1
Sequence:CCGGTGATGGTGTACACCGAGTTTCCTCGAGGAAACTCGGTGTACACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038704.1-1901s21c1
Sequence:CCGGATTTCACCATTAGAGTCATTTCTCGAGAAATGACTCTAATGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175904
C17orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 47
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000181109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175904.2-1865s1c1
Sequence:CCGGCCTGAAGAAGCAGAGGAACTTCTCGAGAAGTTCCTCTGCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175904
C17orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 47
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000181109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175904.2-1865s1c1
Sequence:CCGGCCTGAAGAAGCAGAGGAACTTCTCGAGAAGTTCCTCTGCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175904
C17orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 47
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000181109    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175904.2-1865s1c1
Sequence:CCGGCCTGAAGAAGCAGAGGAACTTCTCGAGAAGTTCCTCTGCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks