EMAIL THIS PAGE TO A FRIEND

C17orf49

chromosome 17 open reading frame 49

35 Gene Product Result for
Synonyms: BAP18 HEPIS
Species: Human C17orf49(124944)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174893 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174893 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049585 predicted 522
2 SASI_Hs01_00049586 predicted 279
3 SASI_Hs01_00049587 predicted 464
4 SASI_Hs01_00049588 predicted 496
5 SASI_Hs01_00049589 predicted 495
6 SASI_Hs01_00049590 predicted 523
7 SASI_Hs01_00049591 predicted 474
8 SASI_Hs02_00368770 predicted 271
9 SASI_Hs01_00049592 predicted 464
10 SASI_Hs01_00049593 predicted 536
11 SASI_Hs01_00049584 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174893
VALIDATED
C17orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 49
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174893.1-275s1c1
Sequence:CCGGCCAGATAAAGGCCACTGTGAACTCGAGTTCACAGTGGCCTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-638s1c1
Sequence:CCGGCTCTGACCTCTCACTGTTCATCTCGAGATGAACAGTGAGAGGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-189s1c1
Sequence:CCGGGAAATAGAGATGCTGAGGGCTCTCGAGAGCCCTCAGCATCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174893.1-231s1c1
Sequence:CCGGGATCTTAATCACATCAGCTGTCTCGAGACAGCTGATGTGATTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-291s1c1
Sequence:CCGGGTGAAACGCAAGGTATATGAACTCGAGTTCATATACCTTGCGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-443s1c1
Sequence:CCGGCATAAAGAAACAGAAGGCTGACTCGAGTCAGCCTTCTGTTTCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-276s1c1
Sequence:CCGGCAGATAAAGGCCACTGTGAAACTCGAGTTTCACAGTGGCCTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-529s1c1
Sequence:CCGGGAGAAACTCCTCCAGCTAAGACTCGAGTCTTAGCTGGAGGAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-550s21c1
Sequence:CCAGACAGTGACGTGGTGGATATTGCTCGAGCAATATCCACCACGTCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-303s21c1
Sequence:CCGGGTCATCAAGGAACGGACAGTGCTCGAGCACTGTCCGTTCCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-532s21c1
Sequence:CCGGTGAACGACTCCGATGCCAACACTCGAGTGTTGGCATCGGAGTCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-226s21c1
Sequence:CCGGAGTGGACGGAGACGGAAATAGCTCGAGCTATTTCCGTCTCCGTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174893
VALIDATED
C17orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 49
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174893.1-275s1c1
Sequence:CCGGCCAGATAAAGGCCACTGTGAACTCGAGTTCACAGTGGCCTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-638s1c1
Sequence:CCGGCTCTGACCTCTCACTGTTCATCTCGAGATGAACAGTGAGAGGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-189s1c1
Sequence:CCGGGAAATAGAGATGCTGAGGGCTCTCGAGAGCCCTCAGCATCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174893.1-231s1c1
Sequence:CCGGGATCTTAATCACATCAGCTGTCTCGAGACAGCTGATGTGATTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-291s1c1
Sequence:CCGGGTGAAACGCAAGGTATATGAACTCGAGTTCATATACCTTGCGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-443s1c1
Sequence:CCGGCATAAAGAAACAGAAGGCTGACTCGAGTCAGCCTTCTGTTTCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-276s1c1
Sequence:CCGGCAGATAAAGGCCACTGTGAAACTCGAGTTTCACAGTGGCCTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-529s1c1
Sequence:CCGGGAGAAACTCCTCCAGCTAAGACTCGAGTCTTAGCTGGAGGAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-550s21c1
Sequence:CCAGACAGTGACGTGGTGGATATTGCTCGAGCAATATCCACCACGTCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-303s21c1
Sequence:CCGGGTCATCAAGGAACGGACAGTGCTCGAGCACTGTCCGTTCCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-532s21c1
Sequence:CCGGTGAACGACTCCGATGCCAACACTCGAGTGTTGGCATCGGAGTCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-226s21c1
Sequence:CCGGAGTGGACGGAGACGGAAATAGCTCGAGCTATTTCCGTCTCCGTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174893
VALIDATED
C17orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 49
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174893.1-275s1c1
Sequence:CCGGCCAGATAAAGGCCACTGTGAACTCGAGTTCACAGTGGCCTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-638s1c1
Sequence:CCGGCTCTGACCTCTCACTGTTCATCTCGAGATGAACAGTGAGAGGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-189s1c1
Sequence:CCGGGAAATAGAGATGCTGAGGGCTCTCGAGAGCCCTCAGCATCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174893.1-231s1c1
Sequence:CCGGGATCTTAATCACATCAGCTGTCTCGAGACAGCTGATGTGATTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-291s1c1
Sequence:CCGGGTGAAACGCAAGGTATATGAACTCGAGTTCATATACCTTGCGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-443s1c1
Sequence:CCGGCATAAAGAAACAGAAGGCTGACTCGAGTCAGCCTTCTGTTTCTTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174893.1-276s1c1
Sequence:CCGGCAGATAAAGGCCACTGTGAAACTCGAGTTTCACAGTGGCCTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_174893.1-529s1c1
Sequence:CCGGGAGAAACTCCTCCAGCTAAGACTCGAGTCTTAGCTGGAGGAGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-550s21c1
Sequence:CCAGACAGTGACGTGGTGGATATTGCTCGAGCAATATCCACCACGTCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-303s21c1
Sequence:CCGGGTCATCAAGGAACGGACAGTGCTCGAGCACTGTCCGTTCCTTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-532s21c1
Sequence:CCGGTGAACGACTCCGATGCCAACACTCGAGTGTTGGCATCGGAGTCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174893.2-226s21c1
Sequence:CCGGAGTGGACGGAGACGGAAATAGCTCGAGCTATTTCCGTCTCCGTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks