EMAIL THIS PAGE TO A FRIEND

C17orf50

chromosome 17 open reading frame 50

20 Gene Product Result for
Species: Human C17orf50(146853)
UniProtKB ID: Q8WW18, Q6Q621
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145272 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037331 MISSION® esiRNA esiRNA human C17orf50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145272 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169834 predicted 717
2 SASI_Hs01_00169833 predicted 724
3 SASI_Hs01_00169835 predicted 446
4 SASI_Hs02_00365144 predicted 510
5 SASI_Hs01_00169836 predicted 651
6 SASI_Hs01_00169837 predicted 649
7 SASI_Hs01_00169838 predicted 497
8 SASI_Hs01_00169839 predicted 522
9 SASI_Hs01_00169840 predicted 620
10 SASI_Hs02_00365145 predicted 712
11 SASI_Hs01_00169841 predicted 630
12 SASI_Hs01_00169842 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145272
C17orf50 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 50
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145272.3-784s21c1
Sequence:CCGGTAACCTAGAGCCCGCTGTCAACTCGAGTTGACAGCGGGCTCTAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145272.3-731s21c1
Sequence:CCGCGTTGGTGCTTGGTTCCCATCTCTCGAGAGATGGGAACCAAGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145272.3-504s21c1
Sequence:CCGGCTATGTGGCGCACTGCGTTCTCTCGAGAGAACGCAGTGCGCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145272.3-459s21c1
Sequence:CCGGGCTCCTCTTCTGCAAGAAATGCTCGAGCATTTCTTGCAGAAGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-455s1c1
Sequence:CCGGCAAGAAATGCAGGAGTCTGCACTCGAGTGCAGACTCCTGCATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145272.2-572s1c1
Sequence:CCGGCCTTTGTGCCCTCCATCATTTCTCGAGAAATGATGGAGGGCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-56s1c1
Sequence:CCGGCTTGTGGAAGAAGGAAACGGACTCGAGTCCGTTTCCTTCTTCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-62s1c1
Sequence:CCGGGAAGAAGGAAACGGAAGAGCTCTCGAGAGCTCTTCCGTTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145272
C17orf50 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 50
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145272.3-784s21c1
Sequence:CCGGTAACCTAGAGCCCGCTGTCAACTCGAGTTGACAGCGGGCTCTAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145272.3-731s21c1
Sequence:CCGCGTTGGTGCTTGGTTCCCATCTCTCGAGAGATGGGAACCAAGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145272.3-504s21c1
Sequence:CCGGCTATGTGGCGCACTGCGTTCTCTCGAGAGAACGCAGTGCGCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145272.3-459s21c1
Sequence:CCGGGCTCCTCTTCTGCAAGAAATGCTCGAGCATTTCTTGCAGAAGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-455s1c1
Sequence:CCGGCAAGAAATGCAGGAGTCTGCACTCGAGTGCAGACTCCTGCATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145272.2-572s1c1
Sequence:CCGGCCTTTGTGCCCTCCATCATTTCTCGAGAAATGATGGAGGGCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-56s1c1
Sequence:CCGGCTTGTGGAAGAAGGAAACGGACTCGAGTCCGTTTCCTTCTTCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-62s1c1
Sequence:CCGGGAAGAAGGAAACGGAAGAGCTCTCGAGAGCTCTTCCGTTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145272
C17orf50 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 50
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145272.3-784s21c1
Sequence:CCGGTAACCTAGAGCCCGCTGTCAACTCGAGTTGACAGCGGGCTCTAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145272.3-731s21c1
Sequence:CCGCGTTGGTGCTTGGTTCCCATCTCTCGAGAGATGGGAACCAAGCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145272.3-504s21c1
Sequence:CCGGCTATGTGGCGCACTGCGTTCTCTCGAGAGAACGCAGTGCGCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145272.3-459s21c1
Sequence:CCGGGCTCCTCTTCTGCAAGAAATGCTCGAGCATTTCTTGCAGAAGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-455s1c1
Sequence:CCGGCAAGAAATGCAGGAGTCTGCACTCGAGTGCAGACTCCTGCATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180026    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145272.2-572s1c1
Sequence:CCGGCCTTTGTGCCCTCCATCATTTCTCGAGAAATGATGGAGGGCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-56s1c1
Sequence:CCGGCTTGTGGAAGAAGGAAACGGACTCGAGTCCGTTTCCTTCTTCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145272.2-62s1c1
Sequence:CCGGGAAGAAGGAAACGGAAGAGCTCTCGAGAGCTCTTCCGTTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks