EMAIL THIS PAGE TO A FRIEND

C17orf51

chromosome 17 open reading frame 51

135 Gene Product Result for
Species: Human C17orf51(339263)
UniProtKB ID: A8MQB3, B2RN29, B5MCL4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA052106 Anti-C17ORF51 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378661 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001113434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001113434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001113434 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221921 MISSION® esiRNA esiRNA targeting human C17orf51 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113434 Rosetta Predictions human pricing
XM_378661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325851 predicted 628
2 SASI_Hs02_00325852 predicted 1078
3 SASI_Hs02_00325853 predicted 1181
4 SASI_Hs02_00325854 predicted 629
5 SASI_Hs02_00325855 predicted 1385
6 SASI_Hs02_00325856 predicted 627
7 SASI_Hs02_00325857 predicted 584
8 SASI_Hs02_00325858 predicted 1148
9 SASI_Hs02_00325859 predicted 1291
10 SASI_Hs02_00325860 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_378661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251604 predicted 1015
2 SASI_Hs01_00251605 predicted 1096
3 SASI_Hs01_00251606 predicted 1206
4 SASI_Hs01_00251607 predicted 1405
5 SASI_Hs01_00251608 predicted 971
6 SASI_Hs01_00251609 predicted 1173
7 SASI_Hs01_00251610 predicted 1311
8 SASI_Hs01_00251611 predicted 886
9 SASI_Hs01_00251612 predicted 1134
10 SASI_Hs01_00251613 predicted 1193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378661
VALIDATED
C17orf51 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 51
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000021489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-2647s1c1
Sequence:CCGGCCGTGAGTAAAGAAAGGCAAACTCGAGTTTGCCTTTCTTTACTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-616s1c1
Sequence:CCGGGATTTGGAAGGAACGAAGTTACTCGAGTAACTTCGTTCCTTCCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-282s1c1
Sequence:CCGGCCGCACGTGTGATCACCCTTACTCGAGTAAGGGTGATCACACGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378661.1-587s1c1
Sequence:CCGGAGCTTTCTGGAGCACCCATTTCTCGAGAAATGGGTGCTCCAGAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378661
VALIDATED
C17orf51 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 51
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000021489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-2647s1c1
Sequence:CCGGCCGTGAGTAAAGAAAGGCAAACTCGAGTTTGCCTTTCTTTACTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-616s1c1
Sequence:CCGGGATTTGGAAGGAACGAAGTTACTCGAGTAACTTCGTTCCTTCCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-282s1c1
Sequence:CCGGCCGCACGTGTGATCACCCTTACTCGAGTAAGGGTGATCACACGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378661.1-587s1c1
Sequence:CCGGAGCTTTCTGGAGCACCCATTTCTCGAGAAATGGGTGCTCCAGAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378661
VALIDATED
C17orf51 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 51
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000021489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-2647s1c1
Sequence:CCGGCCGTGAGTAAAGAAAGGCAAACTCGAGTTTGCCTTTCTTTACTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-616s1c1
Sequence:CCGGGATTTGGAAGGAACGAAGTTACTCGAGTAACTTCGTTCCTTCCAAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_378661.1-282s1c1
Sequence:CCGGCCGCACGTGTGATCACCCTTACTCGAGTAAGGGTGATCACACGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378661.1-587s1c1
Sequence:CCGGAGCTTTCTGGAGCACCCATTTCTCGAGAAATGGGTGCTCCAGAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113434
C17orf51 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 51
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-528s21c1
Sequence:CCGGCCATTCTGATGACGTCCTGTACTCGAGTACAGGACGTCATCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113434.3-1108s21c1
Sequence:CCGGTGAAACTCAGGGTCTTCATTTCTCGAGAAATGAAGACCCTGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-769s21c1
Sequence:CCGGCATCCAGTCTCTGAAGCTTTGCTCGAGCAAAGCTTCAGAGACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-580s21c1
Sequence:CCGGTCTGTGCAGAGACGAGCAAAGCTCGAGCTTTGCTCGTCTCTGCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-890s21c1
Sequence:CCGGTGCTGCATGCCCTCTTCTTTGCTCGAGCAAAGAAGAGGGCATGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113434
C17orf51 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 51
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-528s21c1
Sequence:CCGGCCATTCTGATGACGTCCTGTACTCGAGTACAGGACGTCATCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113434.3-1108s21c1
Sequence:CCGGTGAAACTCAGGGTCTTCATTTCTCGAGAAATGAAGACCCTGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-769s21c1
Sequence:CCGGCATCCAGTCTCTGAAGCTTTGCTCGAGCAAAGCTTCAGAGACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-580s21c1
Sequence:CCGGTCTGTGCAGAGACGAGCAAAGCTCGAGCTTTGCTCGTCTCTGCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-890s21c1
Sequence:CCGGTGCTGCATGCCCTCTTCTTTGCTCGAGCAAAGAAGAGGGCATGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113434
C17orf51 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 51
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-528s21c1
Sequence:CCGGCCATTCTGATGACGTCCTGTACTCGAGTACAGGACGTCATCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113434.3-1108s21c1
Sequence:CCGGTGAAACTCAGGGTCTTCATTTCTCGAGAAATGAAGACCCTGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-769s21c1
Sequence:CCGGCATCCAGTCTCTGAAGCTTTGCTCGAGCAAAGCTTCAGAGACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-580s21c1
Sequence:CCGGTCTGTGCAGAGACGAGCAAAGCTCGAGCTTTGCTCGTCTCTGCACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113434.3-890s21c1
Sequence:CCGGTGCTGCATGCCCTCTTCTTTGCTCGAGCAAAGAAGAGGGCATGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks