EMAIL THIS PAGE TO A FRIEND

C17orf53

chromosome 17 open reading frame 53

46 Gene Product Result for
Species: Human C17orf53(78995)
UniProtKB ID: Q8N3J3, A8K7A9, Q9BWM9, Q9HAI1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024032 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090691 MISSION® esiRNA esiRNA human C17orf53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024032 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356457 predicted 644
2 SASI_Hs01_00035906 predicted 1098
3 SASI_Hs01_00035907 predicted 1043
4 SASI_Hs01_00035908 predicted 2197
5 SASI_Hs01_00035909 predicted 784
6 SASI_Hs01_00035910 predicted 1889
7 SASI_Hs01_00035911 predicted 503
8 SASI_Hs01_00035912 predicted 1114
9 SASI_Hs01_00035913 predicted 1495
10 SASI_Hs01_00035914 predicted 1878
11 SASI_Hs01_00035915 predicted 1858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024032
VALIDATED
C17orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 53
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-811s21c1
Sequence:CCGGGAGGGTTCAGTATTGGCTAAACTCGAGTTTAGCCAATACTGAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-313s21c1
Sequence:CCGGGATGCAGAGAACCGGTTTACTCTCGAGAGTAAACCGGTTCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-1515s21c1
Sequence:CCGGCCATGGTGCTCTGGCTAAATTCTCGAGAATTTAGCCAGAGCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024032.2-1178s1c1
Sequence:CCGGCTCTGGATTATTTCCTCGGATCTCGAGATCCGAGGAAATAATCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024032.2-641s1c1
Sequence:CCGGGCCTGAACAAGACGAATTTGACTCGAGTCAAATTCGTCTTGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024032.2-1882s1c1
Sequence:CCGGCCAACAACCTGGTCCATATTTCTCGAGAAATATGGACCAGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024032.2-1548s1c1
Sequence:CCGGCTGACCATGAAATCCACGCTACTCGAGTAGCGTGGATTTCATGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024032
VALIDATED
C17orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 53
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-811s21c1
Sequence:CCGGGAGGGTTCAGTATTGGCTAAACTCGAGTTTAGCCAATACTGAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-313s21c1
Sequence:CCGGGATGCAGAGAACCGGTTTACTCTCGAGAGTAAACCGGTTCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-1515s21c1
Sequence:CCGGCCATGGTGCTCTGGCTAAATTCTCGAGAATTTAGCCAGAGCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024032.2-1178s1c1
Sequence:CCGGCTCTGGATTATTTCCTCGGATCTCGAGATCCGAGGAAATAATCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024032.2-641s1c1
Sequence:CCGGGCCTGAACAAGACGAATTTGACTCGAGTCAAATTCGTCTTGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024032.2-1882s1c1
Sequence:CCGGCCAACAACCTGGTCCATATTTCTCGAGAAATATGGACCAGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024032.2-1548s1c1
Sequence:CCGGCTGACCATGAAATCCACGCTACTCGAGTAGCGTGGATTTCATGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024032
VALIDATED
C17orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 53
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-811s21c1
Sequence:CCGGGAGGGTTCAGTATTGGCTAAACTCGAGTTTAGCCAATACTGAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-313s21c1
Sequence:CCGGGATGCAGAGAACCGGTTTACTCTCGAGAGTAAACCGGTTCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024032.3-1515s21c1
Sequence:CCGGCCATGGTGCTCTGGCTAAATTCTCGAGAATTTAGCCAGAGCACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024032.2-1178s1c1
Sequence:CCGGCTCTGGATTATTTCCTCGGATCTCGAGATCCGAGGAAATAATCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024032.2-641s1c1
Sequence:CCGGGCCTGAACAAGACGAATTTGACTCGAGTCAAATTCGTCTTGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024032.2-1882s1c1
Sequence:CCGGCCAACAACCTGGTCCATATTTCTCGAGAAATATGGACCAGGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024032.2-1548s1c1
Sequence:CCGGCTGACCATGAAATCCACGCTACTCGAGTAGCGTGGATTTCATGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks