EMAIL THIS PAGE TO A FRIEND

C17orf58

chromosome 17 open reading frame 58

60 Gene Product Result for
UniProtKB ID: Q2M2W7, A8MQV2
Gene ID:
chicken(417421) chromosome 18 open reading frame, human C17orf58
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181655 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035061 MISSION® esiRNA esiRNA human C17orf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181655 Rosetta Predictions human pricing
NM_181656 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370236 predicted 667
2 SASI_Hs02_00370237 predicted 666
3 SASI_Hs02_00370238 predicted 656
4 SASI_Hs01_00027466 predicted 656
5 SASI_Hs02_00370239 predicted 649
6 SASI_Hs01_00027469 predicted 632
7 SASI_Hs02_00370240 predicted 655
8 SASI_Hs02_00370241 predicted 642
9 SASI_Hs02_00370242 predicted 617
10 SASI_Hs02_00370243 predicted 680
11 SASI_Hs01_00027467 predicted 461
12 SASI_Hs01_00027468 predicted 303
13 SASI_Hs01_00027470 predicted 690
14 SASI_Hs01_00027471 predicted 542
15 SASI_Hs01_00027472 predicted 977
16 SASI_Hs01_00027473 predicted 636
17 SASI_Hs01_00027474 predicted 449
18 SASI_Hs01_00027475 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370244 predicted 811
2 SASI_Hs02_00370245 predicted 807
3 SASI_Hs02_00370246 predicted 799
4 SASI_Hs01_00194553 predicted 796
5 SASI_Hs02_00370247 predicted 784
6 SASI_Hs01_00194557 predicted 773
7 SASI_Hs02_00370248 predicted 797
8 SASI_Hs02_00370249 predicted 779
9 SASI_Hs02_00370250 predicted 758
10 SASI_Hs02_00370251 predicted 817
11 SASI_Hs01_00194554 predicted 341
12 SASI_Hs01_00194555 predicted 658
13 SASI_Hs01_00194556 predicted 650
14 SASI_Hs01_00194558 predicted 472
15 SASI_Hs01_00194559 predicted 371
16 SASI_Hs01_00194560 predicted 891
17 SASI_Hs01_00194561 predicted 472
18 SASI_Hs01_00194562 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181655
VALIDATED
C17orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 58
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-455s1c1
Sequence:CCGGCAAGGTGCAGTTCATACCCAACTCGAGTTGGGTATGAACTGCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181655.1-265s1c1
Sequence:CCGGCAATAAGCCGTGTCCAGAGTTCTCGAGAACTCTGGACACGGCTTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181655.1-461s1c1
Sequence:CCGGGCAGTTCATACCCAATGCATTCTCGAGAATGCATTGGGTATGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-631s1c1
Sequence:CCGGCGAAGGTGTCACTTTGTTATTCTCGAGAATAACAAAGTGACACCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-448s1c1
Sequence:CCGGGCAGATTCAAGGTGCAGTTCACTCGAGTGAACTGCACCTTGAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181655.1-462s1c1
Sequence:CCGGCAGTTCATACCCAATGCATTTCTCGAGAAATGCATTGGGTATGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-591s21c1
Sequence:CCGGTCATACCCAATGCATTTGAAACTCGAGTTTCAAATGCATTGGGTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-426s21c1
Sequence:CCGGGTATATTGTGATGGGCCACATCTCGAGATGTGGCCCATCACAATATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-375s21c1
Sequence:CCGGGGACTCCTCCAGCTGCAATAACTCGAGTTATTGCAGCTGGAGGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-582s21c1
Sequence:CCGGAGGTGCAATTCATACCCAATGCTCGAGCATTGGGTATGAATTGCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-608s21c1
Sequence:CCGGGAAACAACCATCCTGGCATTTCTCGAGAAATGCCAGGATGGTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-571s21c1
Sequence:CCGGGGGCAGATTCAAGGTGCAATTCTCGAGAATTGCACCTTGAATCTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181655
VALIDATED
C17orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 58
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-455s1c1
Sequence:CCGGCAAGGTGCAGTTCATACCCAACTCGAGTTGGGTATGAACTGCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181655.1-265s1c1
Sequence:CCGGCAATAAGCCGTGTCCAGAGTTCTCGAGAACTCTGGACACGGCTTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181655.1-461s1c1
Sequence:CCGGGCAGTTCATACCCAATGCATTCTCGAGAATGCATTGGGTATGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-631s1c1
Sequence:CCGGCGAAGGTGTCACTTTGTTATTCTCGAGAATAACAAAGTGACACCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-448s1c1
Sequence:CCGGGCAGATTCAAGGTGCAGTTCACTCGAGTGAACTGCACCTTGAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181655.1-462s1c1
Sequence:CCGGCAGTTCATACCCAATGCATTTCTCGAGAAATGCATTGGGTATGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-591s21c1
Sequence:CCGGTCATACCCAATGCATTTGAAACTCGAGTTTCAAATGCATTGGGTATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-426s21c1
Sequence:CCGGGTATATTGTGATGGGCCACATCTCGAGATGTGGCCCATCACAATATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-375s21c1
Sequence:CCGGGGACTCCTCCAGCTGCAATAACTCGAGTTATTGCAGCTGGAGGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-582s21c1
Sequence:CCGGAGGTGCAATTCATACCCAATGCTCGAGCATTGGGTATGAATTGCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-608s21c1
Sequence:CCGGGAAACAACCATCCTGGCATTTCTCGAGAAATGCCAGGATGGTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-571s21c1
Sequence:CCGGGGGCAGATTCAAGGTGCAATTCTCGAGAATTGCACCTTGAATCTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181655
VALIDATED
C17orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 58
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-455s1c1
Sequence:CCGGCAAGGTGCAGTTCATACCCAACTCGAGTTGGGTATGAACTGCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181655.1-265s1c1
Sequence:CCGGCAATAAGCCGTGTCCAGAGTTCTCGAGAACTCTGGACACGGCTTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181655.1-461s1c1
Sequence:CCGGGCAGTTCATACCCAATGCATTCTCGAGAATGCATTGGGTATGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-631s1c1
Sequence:CCGGCGAAGGTGTCACTTTGTTATTCTCGAGAATAACAAAGTGACACCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_181655.1-448s1c1
Sequence:CCGGGCAGATTCAAGGTGCAGTTCACTCGAGTGAACTGCACCTTGAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181655.1-462s1c1
Sequence:CCGGCAGTTCATACCCAATGCATTTCTCGAGAAATGCATTGGGTATGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-591s21c1
Sequence:CCGGTCATACCCAATGCATTTGAAACTCGAGTTTCAAATGCATTGGGTATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-426s21c1
Sequence:CCGGGTATATTGTGATGGGCCACATCTCGAGATGTGGCCCATCACAATATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-375s21c1
Sequence:CCGGGGACTCCTCCAGCTGCAATAACTCGAGTTATTGCAGCTGGAGGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-582s21c1
Sequence:CCGGAGGTGCAATTCATACCCAATGCTCGAGCATTGGGTATGAATTGCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-608s21c1
Sequence:CCGGGAAACAACCATCCTGGCATTTCTCGAGAAATGCCAGGATGGTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181655.2-571s21c1
Sequence:CCGGGGGCAGATTCAAGGTGCAATTCTCGAGAATTGCACCTTGAATCTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)