EMAIL THIS PAGE TO A FRIEND

C17orf59

chromosome 17 open reading frame 59

90 Gene Product Result for
Synonyms: PRO2472
UniProtKB ID: Q96GS4, Q53HS4, Q9NXW8
Gene ID:
chicken(421818) chromosome 3 open reading frame, human C17orf59
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017622 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017622 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104669 predicted 1308
2 SASI_Hs01_00104670 predicted 961
3 SASI_Hs01_00104672 predicted 1330
4 SASI_Hs01_00104675 predicted 1153
5 SASI_Hs01_00104676 predicted 836
6 SASI_Hs02_00350294 predicted 1106
7 SASI_Hs01_00104677 predicted 859
8 SASI_Hs02_00350295 predicted 950
9 SASI_Hs02_00350296 predicted 1212
10 SASI_Hs02_00350297 predicted 1486
11 SASI_Hs01_00104668 predicted 1059
12 SASI_Hs01_00104671 predicted 580
13 SASI_Hs01_00104673 predicted 1104
14 SASI_Hs01_00104674 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017622
C17orf59 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 59
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-769s21c1
Sequence:CCGGGCAACTCAAGATCCGTCTGAGCTCGAGCTCAGACGGATCTTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017622.2-1508s21c1
Sequence:CCGGGACGTGACTCCCACATGTAATCTCGAGATTACATGTGGGAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-1043s21c1
Sequence:CCGGATGAGCATCAAGGGCATGTACCTCGAGGTACATGCCCTTGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-161s21c1
Sequence:CCGGGAACATCAGGCCCTAGTCTTTCTCGAGAAAGACTAGGGCCTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-745s21c1
Sequence:CCGGTACCCACTTTGTCGCCAACAACTCGAGTTGTTGGCGACAAAGTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017622.1-850s1c1
Sequence:CCGGCTTAGGTGAAGCCGTGGACATCTCGAGATGTCCACGGCTTCACCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017622
C17orf59 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 59
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-769s21c1
Sequence:CCGGGCAACTCAAGATCCGTCTGAGCTCGAGCTCAGACGGATCTTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017622.2-1508s21c1
Sequence:CCGGGACGTGACTCCCACATGTAATCTCGAGATTACATGTGGGAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-1043s21c1
Sequence:CCGGATGAGCATCAAGGGCATGTACCTCGAGGTACATGCCCTTGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-161s21c1
Sequence:CCGGGAACATCAGGCCCTAGTCTTTCTCGAGAAAGACTAGGGCCTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-745s21c1
Sequence:CCGGTACCCACTTTGTCGCCAACAACTCGAGTTGTTGGCGACAAAGTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017622.1-850s1c1
Sequence:CCGGCTTAGGTGAAGCCGTGGACATCTCGAGATGTCCACGGCTTCACCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017622
C17orf59 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 59
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-769s21c1
Sequence:CCGGGCAACTCAAGATCCGTCTGAGCTCGAGCTCAGACGGATCTTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017622.2-1508s21c1
Sequence:CCGGGACGTGACTCCCACATGTAATCTCGAGATTACATGTGGGAGTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-1043s21c1
Sequence:CCGGATGAGCATCAAGGGCATGTACCTCGAGGTACATGCCCTTGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-161s21c1
Sequence:CCGGGAACATCAGGCCCTAGTCTTTCTCGAGAAAGACTAGGGCCTGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017622.2-745s21c1
Sequence:CCGGTACCCACTTTGTCGCCAACAACTCGAGTTGTTGGCGACAAAGTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017622.1-850s1c1
Sequence:CCGGCTTAGGTGAAGCCGTGGACATCTCGAGATGTCCACGGCTTCACCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks