EMAIL THIS PAGE TO A FRIEND

C17orf62

chromosome 17 open reading frame 62

43 Gene Product Result for
Species: Human C17orf62(79415)
UniProtKB ID: Q9BQA9, E1B6X3, Q96NR1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033046 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071881 MISSION® esiRNA esiRNA human C17orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033046 Rosetta Predictions human pricing
NM_001100407 Rosetta Predictions human pricing
NM_001100408 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242324 predicted 503
2 SASI_Hs02_00307979 predicted 507
3 SASI_Hs02_00307980 predicted 590
4 SASI_Hs01_00242325 predicted 992
5 SASI_Hs01_00242326 predicted 1012
6 SASI_Hs01_00242328 predicted 1042
7 SASI_Hs01_00242329 predicted 661
8 SASI_Hs01_00242331 predicted 615
9 SASI_Hs01_00242332 predicted 1077
10 SASI_Hs01_00242327 predicted 292
11 SASI_Hs01_00242330 predicted 314
12 SASI_Hs01_00242333 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321954 predicted 559
2 SASI_Hs02_00321955 predicted 557
3 SASI_Hs02_00321956 predicted 644
4 SASI_Hs02_00321957 predicted 1042
5 SASI_Hs02_00321958 predicted 1056
6 SASI_Hs02_00321959 predicted 1100
7 SASI_Hs02_00321960 predicted 711
8 SASI_Hs02_00321961 predicted 666
9 SASI_Hs02_00321962 predicted 1134
10 SASI_Hs02_00321963 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321964 predicted 464
2 SASI_Hs02_00321965 predicted 464
3 SASI_Hs02_00321966 predicted 549
4 SASI_Hs02_00321967 predicted 944
5 SASI_Hs02_00321968 predicted 964
6 SASI_Hs02_00321969 predicted 1001
7 SASI_Hs02_00321970 predicted 623
8 SASI_Hs02_00321971 predicted 568
9 SASI_Hs02_00321972 predicted 1041
10 SASI_Hs02_00321973 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024510
VALIDATED
C17orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 62
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024510.2-1564s1c1
Sequence:CCGGCTCACACTCAGCTTCAGCATACTCGAGTATGCTGAAGCTGAGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1750s1c1
Sequence:CCGGCAGCAAGATCCTGTCTTTGTACTCGAGTACAAAGACAGGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1659s1c1
Sequence:CCGGGCAGTGGTTCATGCCAGTAATCTCGAGATTACTGGCATGAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1156s1c1
Sequence:CCGGGCTTGCACACTGCATGAAACACTCGAGTGTTTCATGCAGTGTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024510
VALIDATED
C17orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 62
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024510.2-1564s1c1
Sequence:CCGGCTCACACTCAGCTTCAGCATACTCGAGTATGCTGAAGCTGAGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1750s1c1
Sequence:CCGGCAGCAAGATCCTGTCTTTGTACTCGAGTACAAAGACAGGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1659s1c1
Sequence:CCGGGCAGTGGTTCATGCCAGTAATCTCGAGATTACTGGCATGAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1156s1c1
Sequence:CCGGGCTTGCACACTGCATGAAACACTCGAGTGTTTCATGCAGTGTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024510
VALIDATED
C17orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 62
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024510.2-1564s1c1
Sequence:CCGGCTCACACTCAGCTTCAGCATACTCGAGTATGCTGAAGCTGAGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1750s1c1
Sequence:CCGGCAGCAAGATCCTGTCTTTGTACTCGAGTACAAAGACAGGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1659s1c1
Sequence:CCGGGCAGTGGTTCATGCCAGTAATCTCGAGATTACTGGCATGAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024510.2-1156s1c1
Sequence:CCGGGCTTGCACACTGCATGAAACACTCGAGTGTTTCATGCAGTGTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033046
VALIDATED
C17orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 62
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000180403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001033046.1-193s1c1
Sequence:CCGGGCTGGTTGGAATCTTGTCGATCTCGAGATCGACAAGATTCCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033046
VALIDATED
C17orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 62
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000180403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001033046.1-193s1c1
Sequence:CCGGGCTGGTTGGAATCTTGTCGATCTCGAGATCGACAAGATTCCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033046
VALIDATED
C17orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 62
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000180403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001033046.1-193s1c1
Sequence:CCGGGCTGGTTGGAATCTTGTCGATCTCGAGATCGACAAGATTCCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks