EMAIL THIS PAGE TO A FRIEND

C17orf64

chromosome 17 open reading frame 64

19 Gene Product Result for
UniProtKB ID: Q86WR6, Q8IY87
Gene ID:
chicken(772176) chromosome 19 open reading frame, human C17orf64
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181707 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016011 MISSION® esiRNA esiRNA targeting human C17orf64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181707 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246308 predicted 486
2 SASI_Hs01_00246309 predicted 693
3 SASI_Hs01_00246310 predicted 460
4 SASI_Hs02_00370310 predicted 496
5 SASI_Hs01_00246314 predicted 555
6 SASI_Hs01_00246315 predicted 456
7 SASI_Hs01_00246316 predicted 619
8 SASI_Hs01_00246317 predicted 571
9 SASI_Hs02_00370311 predicted 458
10 SASI_Hs02_00370312 predicted 522
11 SASI_Hs01_00246311 predicted 458
12 SASI_Hs01_00246312 predicted 680
13 SASI_Hs01_00246313 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181707
C17orf64 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 64
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-460s1c1
Sequence:CCGGCTTCGCCGACTTTACAAGTACCTCGAGGTACTTGTAAAGTCGGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-464s1c1
Sequence:CCGGGCCGACTTTACAAGTACACCACTCGAGTGGTGTACTTGTAAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-766s1c1
Sequence:CCGGCCAGAAACTCCAGAGACTGAACTCGAGTTCAGTCTCTGGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-459s1c1
Sequence:CCGGGCTTCGCCGACTTTACAAGTACTCGAGTACTTGTAAAGTCGGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-741s1c1
Sequence:CCGGCAAGAGGAAGAGGATAAAGGACTCGAGTCCTTTATCCTCTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-706s1c1
Sequence:CCGGGATTCTTTAAGGGAGCTTTCTCTCGAGAGAAAGCTCCCTTAAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-702s1c1
Sequence:CCGGGAAAGATTCTTTAAGGGAGCTCTCGAGAGCTCCCTTAAAGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-467s1c1
Sequence:CCGGGACTTTACAAGTACACCAAGACTCGAGTCTTGGTGTACTTGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-699s1c1
Sequence:CCGGCAAGAAAGATTCTTTAAGGGACTCGAGTCCCTTAAAGAATCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-693s1c1
Sequence:CCGGCCATGTCAAGAAAGATTCTTTCTCGAGAAAGAATCTTTCTTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-466s1c1
Sequence:CCGGCGACTTTACAAGTACACCAAGCTCGAGCTTGGTGTACTTGTAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181707
C17orf64 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 64
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-460s1c1
Sequence:CCGGCTTCGCCGACTTTACAAGTACCTCGAGGTACTTGTAAAGTCGGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-464s1c1
Sequence:CCGGGCCGACTTTACAAGTACACCACTCGAGTGGTGTACTTGTAAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-766s1c1
Sequence:CCGGCCAGAAACTCCAGAGACTGAACTCGAGTTCAGTCTCTGGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-459s1c1
Sequence:CCGGGCTTCGCCGACTTTACAAGTACTCGAGTACTTGTAAAGTCGGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-741s1c1
Sequence:CCGGCAAGAGGAAGAGGATAAAGGACTCGAGTCCTTTATCCTCTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-706s1c1
Sequence:CCGGGATTCTTTAAGGGAGCTTTCTCTCGAGAGAAAGCTCCCTTAAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-702s1c1
Sequence:CCGGGAAAGATTCTTTAAGGGAGCTCTCGAGAGCTCCCTTAAAGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-467s1c1
Sequence:CCGGGACTTTACAAGTACACCAAGACTCGAGTCTTGGTGTACTTGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-699s1c1
Sequence:CCGGCAAGAAAGATTCTTTAAGGGACTCGAGTCCCTTAAAGAATCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-693s1c1
Sequence:CCGGCCATGTCAAGAAAGATTCTTTCTCGAGAAAGAATCTTTCTTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-466s1c1
Sequence:CCGGCGACTTTACAAGTACACCAAGCTCGAGCTTGGTGTACTTGTAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181707
C17orf64 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 64
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-460s1c1
Sequence:CCGGCTTCGCCGACTTTACAAGTACCTCGAGGTACTTGTAAAGTCGGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-464s1c1
Sequence:CCGGGCCGACTTTACAAGTACACCACTCGAGTGGTGTACTTGTAAAGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-766s1c1
Sequence:CCGGCCAGAAACTCCAGAGACTGAACTCGAGTTCAGTCTCTGGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-459s1c1
Sequence:CCGGGCTTCGCCGACTTTACAAGTACTCGAGTACTTGTAAAGTCGGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-741s1c1
Sequence:CCGGCAAGAGGAAGAGGATAAAGGACTCGAGTCCTTTATCCTCTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-706s1c1
Sequence:CCGGGATTCTTTAAGGGAGCTTTCTCTCGAGAGAAAGCTCCCTTAAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-702s1c1
Sequence:CCGGGAAAGATTCTTTAAGGGAGCTCTCGAGAGCTCCCTTAAAGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-467s1c1
Sequence:CCGGGACTTTACAAGTACACCAAGACTCGAGTCTTGGTGTACTTGTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-699s1c1
Sequence:CCGGCAAGAAAGATTCTTTAAGGGACTCGAGTCCCTTAAAGAATCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-693s1c1
Sequence:CCGGCCATGTCAAGAAAGATTCTTTCTCGAGAAAGAATCTTTCTTGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181707.1-466s1c1
Sequence:CCGGCGACTTTACAAGTACACCAAGCTCGAGCTTGGTGTACTTGTAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks