EMAIL THIS PAGE TO A FRIEND

C17orf67

chromosome 17 open reading frame 67

24 Gene Product Result for
Species: Human C17orf67(339210)
UniProtKB ID: Q0P5P2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085430 Rosetta Predictions human pricing
XM_378687 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317705 predicted 320
2 SASI_Hs02_00317706 predicted 460
3 SASI_Hs02_00317707 predicted 324
4 SASI_Hs02_00317708 predicted 217
5 SASI_Hs02_00317709 predicted 404
6 SASI_Hs02_00317710 predicted 395
7 SASI_Hs02_00317711 predicted 449
8 SASI_Hs02_00317712 predicted 386
9 SASI_Hs02_00317713 predicted 388
10 SASI_Hs02_00317714 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_378687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273699 predicted 1662
2 SASI_Hs01_00273700 predicted 1524
3 SASI_Hs01_00273701 predicted 1674
4 SASI_Hs01_00273702 predicted 1417
5 SASI_Hs01_00273703 predicted 1608
6 SASI_Hs01_00273704 predicted 1687
7 SASI_Hs01_00273705 predicted 1313
8 SASI_Hs01_00273706 predicted 1587
9 SASI_Hs01_00273707 predicted 1356
10 SASI_Hs01_00273708 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085430
C17orf67 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 67
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-99s21c1
Sequence:CCGGTCGTGCTGTCTCTTACCTTACCTCGAGGTAAGGTAAGAGACAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085430.1-537s21c1
Sequence:CCGGTAACCTGCATAGATCACTAAACTCGAGTTTAGTGATCTATGCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-197s21c1
Sequence:CCGGAGACCAAGCAAACCCGGATTCCTCGAGGAATCCGGGTTTGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-71s21c1
Sequence:CCGGCAAGGCAGGATGAAGACATTGCTCGAGCAATGTCTTCATCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-220s21c1
Sequence:CCGGCGATGAGCCAATGCGGGAATACTCGAGTATTCCCGCATTGGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085430
C17orf67 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 67
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-99s21c1
Sequence:CCGGTCGTGCTGTCTCTTACCTTACCTCGAGGTAAGGTAAGAGACAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085430.1-537s21c1
Sequence:CCGGTAACCTGCATAGATCACTAAACTCGAGTTTAGTGATCTATGCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-197s21c1
Sequence:CCGGAGACCAAGCAAACCCGGATTCCTCGAGGAATCCGGGTTTGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-71s21c1
Sequence:CCGGCAAGGCAGGATGAAGACATTGCTCGAGCAATGTCTTCATCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-220s21c1
Sequence:CCGGCGATGAGCCAATGCGGGAATACTCGAGTATTCCCGCATTGGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085430
C17orf67 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 67
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-99s21c1
Sequence:CCGGTCGTGCTGTCTCTTACCTTACCTCGAGGTAAGGTAAGAGACAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085430.1-537s21c1
Sequence:CCGGTAACCTGCATAGATCACTAAACTCGAGTTTAGTGATCTATGCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-197s21c1
Sequence:CCGGAGACCAAGCAAACCCGGATTCCTCGAGGAATCCGGGTTTGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-71s21c1
Sequence:CCGGCAAGGCAGGATGAAGACATTGCTCGAGCAATGTCTTCATCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085430.1-220s21c1
Sequence:CCGGCGATGAGCCAATGCGGGAATACTCGAGTATTCCCGCATTGGCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks