EMAIL THIS PAGE TO A FRIEND

C17orf70

chromosome 17 open reading frame 70

35 Gene Product Result for
Synonyms: FAAP100
Species: Human C17orf70(80233)
Gene ID:
Human(80233) Summary: FAAP100 is a component of the Fanconi anemia (FA; MIM 277650) core complex and is required for core complex stability and FANCD2 (see MIM 227646) monoubiquitination (Ling et al., 2007 [PubMed 17396147]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025161 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140301 MISSION® esiRNA esiRNA human C17orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109760 Rosetta Predictions human pricing
NM_025161 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324733 predicted 3178
2 SASI_Hs02_00324734 predicted 2827
3 SASI_Hs02_00324735 predicted 1502
4 SASI_Hs02_00324736 predicted 1474
5 SASI_Hs02_00324737 predicted 2809
6 SASI_Hs02_00324738 predicted 2388
7 SASI_Hs02_00324739 predicted 2463
8 SASI_Hs02_00324740 predicted 1243
9 SASI_Hs02_00324741 predicted 2824
10 SASI_Hs02_00324742 predicted 2827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244674 predicted 3392
2 SASI_Hs01_00244675 predicted 3045
3 SASI_Hs01_00244676 predicted 1710
4 SASI_Hs01_00244677 predicted 1680
5 SASI_Hs01_00244678 predicted 3018
6 SASI_Hs01_00244679 predicted 2607
7 SASI_Hs01_00244680 predicted 2670
8 SASI_Hs01_00244681 predicted 1455
9 SASI_Hs02_00357917 predicted 3036
10 SASI_Hs02_00357918 predicted 3034
11 SASI_Hs01_00244682 predicted 1589
12 SASI_Hs01_00244683 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025161
C17orf70 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 70
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025161.5-2851s21c1
Sequence:CCGGGGAGCAGAACGCTCATGAAAGCTCGAGCTTTCATGAGCGTTCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025161.5-3125s21c1
Sequence:CCGGGGGTGAGTTTGTAACTGTTGCCTCGAGGCAACAGTTACAAACTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025161.5-1873s21c1
Sequence:CCGGCACGCTGTTCTACAGTCTCAGCTCGAGCTGAGACTGTAGAACAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1043s1c1
Sequence:CCGGCCCAAATGCCCTTGTCAAGATCTCGAGATCTTGACAAGGGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1616s1c1
Sequence:CCGGGCTGTCTGGAATTGGCAACATCTCGAGATGTTGCCAATTCCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025161.3-3056s1c1
Sequence:CCGGGAGCACAAAGCAGATTCTGATCTCGAGATCAGAATCTGCTTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1634s1c1
Sequence:CCGGCATCTCTGAGAGAGTGTCTTTCTCGAGAAAGACACTCTCTCAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1630s1c1
Sequence:CCGGGCAACATCTCTGAGAGAGTGTCTCGAGACACTCTCTCAGAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025161
C17orf70 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 70
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025161.5-2851s21c1
Sequence:CCGGGGAGCAGAACGCTCATGAAAGCTCGAGCTTTCATGAGCGTTCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025161.5-3125s21c1
Sequence:CCGGGGGTGAGTTTGTAACTGTTGCCTCGAGGCAACAGTTACAAACTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025161.5-1873s21c1
Sequence:CCGGCACGCTGTTCTACAGTCTCAGCTCGAGCTGAGACTGTAGAACAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1043s1c1
Sequence:CCGGCCCAAATGCCCTTGTCAAGATCTCGAGATCTTGACAAGGGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1616s1c1
Sequence:CCGGGCTGTCTGGAATTGGCAACATCTCGAGATGTTGCCAATTCCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025161.3-3056s1c1
Sequence:CCGGGAGCACAAAGCAGATTCTGATCTCGAGATCAGAATCTGCTTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1634s1c1
Sequence:CCGGCATCTCTGAGAGAGTGTCTTTCTCGAGAAAGACACTCTCTCAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1630s1c1
Sequence:CCGGGCAACATCTCTGAGAGAGTGTCTCGAGACACTCTCTCAGAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025161
C17orf70 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 70
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025161.5-2851s21c1
Sequence:CCGGGGAGCAGAACGCTCATGAAAGCTCGAGCTTTCATGAGCGTTCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025161.5-3125s21c1
Sequence:CCGGGGGTGAGTTTGTAACTGTTGCCTCGAGGCAACAGTTACAAACTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025161.5-1873s21c1
Sequence:CCGGCACGCTGTTCTACAGTCTCAGCTCGAGCTGAGACTGTAGAACAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1043s1c1
Sequence:CCGGCCCAAATGCCCTTGTCAAGATCTCGAGATCTTGACAAGGGCATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1616s1c1
Sequence:CCGGGCTGTCTGGAATTGGCAACATCTCGAGATGTTGCCAATTCCAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025161.3-3056s1c1
Sequence:CCGGGAGCACAAAGCAGATTCTGATCTCGAGATCAGAATCTGCTTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1634s1c1
Sequence:CCGGCATCTCTGAGAGAGTGTCTTTCTCGAGAAAGACACTCTCTCAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025161.3-1630s1c1
Sequence:CCGGGCAACATCTCTGAGAGAGTGTCTCGAGACACTCTCTCAGAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks