EMAIL THIS PAGE TO A FRIEND

C17orf72

chromosome 17 open reading frame 72

13 Gene Product Result for
Species: Human C17orf72(92340)
UniProtKB ID: P0C7W0, B3KMP0, B4DZJ9, B4E2F8, E9PGL5, J3QKX4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164257 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219961 MISSION® esiRNA esiRNA targeting human C17orf72 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_015354 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381142 predicted 961
2 SASI_Hs02_00381143 predicted 1702
3 SASI_Hs02_00381144 predicted 1600
4 SASI_Hs02_00381145 predicted 1741
5 SASI_Hs02_00381146 predicted 1821
6 SASI_Hs02_00381147 predicted 1697
7 SASI_Hs02_00381148 predicted 1881
8 SASI_Hs02_00381149 predicted 1843
9 SASI_Hs02_00381150 predicted 1678
10 SASI_Hs02_00381151 predicted 1890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164257
C17orf72 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 72
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-261s21c1
Sequence:CCGGTACCTGGAGGTTCCACAGGAACTCGAGTTCCTGTGGAACCTCCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-416s21c1
Sequence:CCGGTGCTTGTCAGCCCTACTTGCACTCGAGTGCAAGTAGGGCTGACAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-342s21c1
Sequence:CCGGCACCACTACTTGCCCTATTTGCTCGAGCAAATAGGGCAAGTAGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-546s21c1
Sequence:CCGGCCGGCTTCAGACTACTATGATCTCGAGATCATAGTAGTCTGAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164257.1-938s21c1
Sequence:CCGGGTCTCCTTCCAGCCTAGTAATCTCGAGATTACTAGGCTGGAAGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-571s21c1
Sequence:CCGGAGAGCCTCCTATGAGGACAGACTCGAGTCTGTCCTCATAGGAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-149s21c1
Sequence:CCGGAGACCTGCTGGAACTGATGATCTCGAGATCATCAGTTCCAGCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164257
C17orf72 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 72
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-261s21c1
Sequence:CCGGTACCTGGAGGTTCCACAGGAACTCGAGTTCCTGTGGAACCTCCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-416s21c1
Sequence:CCGGTGCTTGTCAGCCCTACTTGCACTCGAGTGCAAGTAGGGCTGACAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-342s21c1
Sequence:CCGGCACCACTACTTGCCCTATTTGCTCGAGCAAATAGGGCAAGTAGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-546s21c1
Sequence:CCGGCCGGCTTCAGACTACTATGATCTCGAGATCATAGTAGTCTGAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164257.1-938s21c1
Sequence:CCGGGTCTCCTTCCAGCCTAGTAATCTCGAGATTACTAGGCTGGAAGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-571s21c1
Sequence:CCGGAGAGCCTCCTATGAGGACAGACTCGAGTCTGTCCTCATAGGAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-149s21c1
Sequence:CCGGAGACCTGCTGGAACTGATGATCTCGAGATCATCAGTTCCAGCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164257
C17orf72 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 72
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-261s21c1
Sequence:CCGGTACCTGGAGGTTCCACAGGAACTCGAGTTCCTGTGGAACCTCCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-416s21c1
Sequence:CCGGTGCTTGTCAGCCCTACTTGCACTCGAGTGCAAGTAGGGCTGACAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-342s21c1
Sequence:CCGGCACCACTACTTGCCCTATTTGCTCGAGCAAATAGGGCAAGTAGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-546s21c1
Sequence:CCGGCCGGCTTCAGACTACTATGATCTCGAGATCATAGTAGTCTGAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164257.1-938s21c1
Sequence:CCGGGTCTCCTTCCAGCCTAGTAATCTCGAGATTACTAGGCTGGAAGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-571s21c1
Sequence:CCGGAGAGCCTCCTATGAGGACAGACTCGAGTCTGTCCTCATAGGAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164257.1-149s21c1
Sequence:CCGGAGACCTGCTGGAACTGATGATCTCGAGATCATCAGTTCCAGCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)