EMAIL THIS PAGE TO A FRIEND

C17orf74

chromosome 17 open reading frame 74

57 Gene Product Result for
Species: Human C17orf74(201243)
UniProtKB ID: Q0P670
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175734 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036161 MISSION® esiRNA esiRNA human C17orf74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175734 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055322 predicted 801
2 SASI_Hs01_00055323 predicted 752
3 SASI_Hs01_00055324 predicted 762
4 SASI_Hs01_00055325 predicted 733
5 SASI_Hs01_00055326 predicted 794
6 SASI_Hs01_00055327 predicted 1397
7 SASI_Hs01_00055328 predicted 1125
8 SASI_Hs01_00055330 predicted 976
9 SASI_Hs01_00055331 predicted 789
10 SASI_Hs02_00369077 predicted 839
11 SASI_Hs01_00055329 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175734
C17orf74 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 74
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-505s21c1
Sequence:CCGGGCCGCAGAACTACAGACAAATCTCGAGATTTGTCTGTAGTTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-135s21c1
Sequence:CCGGACGATGCCGAGGACATCTTACCTCGAGGTAAGATGTCCTCGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-171s21c1
Sequence:CCGGTCATCGTTCTTGTCAACATTGCTCGAGCAATGTTGACAAGAACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-235s21c1
Sequence:CCGGCTTAGACAAGATGATTGATTGCTCGAGCAATCAATCATCTTGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-200s1c1
Sequence:CCGGGTGGCAACTATGATGTGGCATCTCGAGATGCCACATCATAGTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-229s1c1
Sequence:CCGGGAACGCCTTAGACAAGATGATCTCGAGATCATCTTGTCTAAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-100s1c1
Sequence:CCGGCGTGAGATGTTGCAATCAATACTCGAGTATTGATTGCAACATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175734
C17orf74 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 74
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-505s21c1
Sequence:CCGGGCCGCAGAACTACAGACAAATCTCGAGATTTGTCTGTAGTTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-135s21c1
Sequence:CCGGACGATGCCGAGGACATCTTACCTCGAGGTAAGATGTCCTCGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-171s21c1
Sequence:CCGGTCATCGTTCTTGTCAACATTGCTCGAGCAATGTTGACAAGAACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-235s21c1
Sequence:CCGGCTTAGACAAGATGATTGATTGCTCGAGCAATCAATCATCTTGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-200s1c1
Sequence:CCGGGTGGCAACTATGATGTGGCATCTCGAGATGCCACATCATAGTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-229s1c1
Sequence:CCGGGAACGCCTTAGACAAGATGATCTCGAGATCATCTTGTCTAAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-100s1c1
Sequence:CCGGCGTGAGATGTTGCAATCAATACTCGAGTATTGATTGCAACATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175734
C17orf74 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 74
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-505s21c1
Sequence:CCGGGCCGCAGAACTACAGACAAATCTCGAGATTTGTCTGTAGTTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-135s21c1
Sequence:CCGGACGATGCCGAGGACATCTTACCTCGAGGTAAGATGTCCTCGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-171s21c1
Sequence:CCGGTCATCGTTCTTGTCAACATTGCTCGAGCAATGTTGACAAGAACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175734.4-235s21c1
Sequence:CCGGCTTAGACAAGATGATTGATTGCTCGAGCAATCAATCATCTTGTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-200s1c1
Sequence:CCGGGTGGCAACTATGATGTGGCATCTCGAGATGCCACATCATAGTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-229s1c1
Sequence:CCGGGAACGCCTTAGACAAGATGATCTCGAGATCATCTTGTCTAAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175734.3-100s1c1
Sequence:CCGGCGTGAGATGTTGCAATCAATACTCGAGTATTGATTGCAACATCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks