EMAIL THIS PAGE TO A FRIEND

C17orf75

chromosome 17 open reading frame 75

23 Gene Product Result for
Synonyms: NJMU-R1
Species: Human C17orf75(64149)
UniProtKB ID: Q9HAS0, Q7Z2H4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022344 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075401 MISSION® esiRNA esiRNA human C17orf75 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022344 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094560 predicted 612
2 SASI_Hs01_00094561 predicted 1001
3 SASI_Hs01_00094562 predicted 1027
4 SASI_Hs01_00094563 predicted 968
5 SASI_Hs02_00355627 predicted 1266
6 SASI_Hs01_00094566 predicted 353
7 SASI_Hs02_00355628 predicted 1007
8 SASI_Hs01_00094568 predicted 744
9 SASI_Hs02_00355629 predicted 1179
10 SASI_Hs01_00094569 predicted 1278
11 SASI_Hs01_00094564 predicted 462
12 SASI_Hs01_00094565 predicted 440
13 SASI_Hs01_00094567 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022344
VALIDATED
C17orf75 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 75
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-844s1c1
Sequence:CCGGGCAGCATAAGTCTGTGGTCATCTCGAGATGACCACAGACTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-433s1c1
Sequence:CCGGGCTTCCTGAAACAGTAACGATCTCGAGATCGTTACTGTTTCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-701s1c1
Sequence:CCGGGCTTTGAGTTACACTCCTGTTCTCGAGAACAGGAGTGTAACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022344.2-1007s1c1
Sequence:CCGGGCCATACAAGACACAAACAATCTCGAGATTGTTTGTGTCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-779s1c1
Sequence:CCGGGCCAGTCTTCAAGGACTTATTCTCGAGAATAAGTCCTTGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-803s1c1
Sequence:CCGGGAAGGCACCATGACTTCTTTGCTCGAGCAAAGAAGTCATGGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022344.2-1320s1c1
Sequence:CCGGGATTTGAAACTCAATCCAGATCTCGAGATCTGGATTGAGTTTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-450s1c1
Sequence:CCGGCGATAGACTCTGAACGTAACCCTCGAGGGTTACGTTCAGAGTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-387s1c1
Sequence:CCGGGTTACCGAGTTGGTTGTTATTCTCGAGAATAACAACCAACTCGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022344
VALIDATED
C17orf75 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 75
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-844s1c1
Sequence:CCGGGCAGCATAAGTCTGTGGTCATCTCGAGATGACCACAGACTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-433s1c1
Sequence:CCGGGCTTCCTGAAACAGTAACGATCTCGAGATCGTTACTGTTTCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-701s1c1
Sequence:CCGGGCTTTGAGTTACACTCCTGTTCTCGAGAACAGGAGTGTAACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022344.2-1007s1c1
Sequence:CCGGGCCATACAAGACACAAACAATCTCGAGATTGTTTGTGTCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-779s1c1
Sequence:CCGGGCCAGTCTTCAAGGACTTATTCTCGAGAATAAGTCCTTGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-803s1c1
Sequence:CCGGGAAGGCACCATGACTTCTTTGCTCGAGCAAAGAAGTCATGGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022344.2-1320s1c1
Sequence:CCGGGATTTGAAACTCAATCCAGATCTCGAGATCTGGATTGAGTTTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-450s1c1
Sequence:CCGGCGATAGACTCTGAACGTAACCCTCGAGGGTTACGTTCAGAGTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-387s1c1
Sequence:CCGGGTTACCGAGTTGGTTGTTATTCTCGAGAATAACAACCAACTCGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022344
VALIDATED
C17orf75 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 75
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-844s1c1
Sequence:CCGGGCAGCATAAGTCTGTGGTCATCTCGAGATGACCACAGACTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-433s1c1
Sequence:CCGGGCTTCCTGAAACAGTAACGATCTCGAGATCGTTACTGTTTCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-701s1c1
Sequence:CCGGGCTTTGAGTTACACTCCTGTTCTCGAGAACAGGAGTGTAACTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022344.2-1007s1c1
Sequence:CCGGGCCATACAAGACACAAACAATCTCGAGATTGTTTGTGTCTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022344.2-779s1c1
Sequence:CCGGGCCAGTCTTCAAGGACTTATTCTCGAGAATAAGTCCTTGAAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-803s1c1
Sequence:CCGGGAAGGCACCATGACTTCTTTGCTCGAGCAAAGAAGTCATGGTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022344.2-1320s1c1
Sequence:CCGGGATTTGAAACTCAATCCAGATCTCGAGATCTGGATTGAGTTTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-450s1c1
Sequence:CCGGCGATAGACTCTGAACGTAACCCTCGAGGGTTACGTTCAGAGTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022344.2-387s1c1
Sequence:CCGGGTTACCGAGTTGGTTGTTATTCTCGAGAATAACAACCAACTCGGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks