EMAIL THIS PAGE TO A FRIEND

C17orf77

chromosome 17 open reading frame 77

19 Gene Product Result for
Species: Human C17orf77(146723)
UniProtKB ID: Q96MU5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152460 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132364 predicted 1238
2 SASI_Hs01_00132365 predicted 1447
3 SASI_Hs01_00132366 predicted 1208
4 SASI_Hs01_00132367 predicted 1450
5 SASI_Hs01_00132368 predicted 1089
6 SASI_Hs01_00132369 predicted 633
7 SASI_Hs01_00132370 predicted 604
8 SASI_Hs01_00132371 predicted 722
9 SASI_Hs01_00132372 predicted 876
10 SASI_Hs02_00366238 predicted 713
11 SASI_Hs01_00132373 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152460
C17orf77 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 77
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152460.2-1452s21c1
Sequence:CCGGTCCAATCCTTGGATCAAATATCTCGAGATATTTGATCCAAGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152460.2-1006s21c1
Sequence:CCGGCCACTGTAAGACATCTCATTGCTCGAGCAATGAGATGTCTTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152460.2-1338s21c1
Sequence:CCGGCCCTCCTGAATCGATTCATTTCTCGAGAAATGAATCGATTCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-650s1c1
Sequence:CCGGCATCTGTAGCTACTTCTCTTTCTCGAGAAAGAGAAGTAGCTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-392s1c1
Sequence:CCGGGACATGTCTCCTTCCTGAGAACTCGAGTTCTCAGGAAGGAGACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-578s1c1
Sequence:CCGGGAATCCAAGCTCGGAAGTCAACTCGAGTTGACTTCCGAGCTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-632s1c1
Sequence:CCGGCTTGCTCACTTCCTGTTACATCTCGAGATGTAACAGGAAGTGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-628s1c1
Sequence:CCGGGTCTCTTGCTCACTTCCTGTTCTCGAGAACAGGAAGTGAGCAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-573s1c1
Sequence:CCGGGACTTGAATCCAAGCTCGGAACTCGAGTTCCGAGCTTGGATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-440s1c1
Sequence:CCGGGCTGTCATTCCAGTGCCTTAACTCGAGTTAAGGCACTGGAATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152460
C17orf77 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 77
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152460.2-1452s21c1
Sequence:CCGGTCCAATCCTTGGATCAAATATCTCGAGATATTTGATCCAAGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152460.2-1006s21c1
Sequence:CCGGCCACTGTAAGACATCTCATTGCTCGAGCAATGAGATGTCTTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152460.2-1338s21c1
Sequence:CCGGCCCTCCTGAATCGATTCATTTCTCGAGAAATGAATCGATTCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-650s1c1
Sequence:CCGGCATCTGTAGCTACTTCTCTTTCTCGAGAAAGAGAAGTAGCTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-392s1c1
Sequence:CCGGGACATGTCTCCTTCCTGAGAACTCGAGTTCTCAGGAAGGAGACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-578s1c1
Sequence:CCGGGAATCCAAGCTCGGAAGTCAACTCGAGTTGACTTCCGAGCTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-632s1c1
Sequence:CCGGCTTGCTCACTTCCTGTTACATCTCGAGATGTAACAGGAAGTGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-628s1c1
Sequence:CCGGGTCTCTTGCTCACTTCCTGTTCTCGAGAACAGGAAGTGAGCAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-573s1c1
Sequence:CCGGGACTTGAATCCAAGCTCGGAACTCGAGTTCCGAGCTTGGATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-440s1c1
Sequence:CCGGGCTGTCATTCCAGTGCCTTAACTCGAGTTAAGGCACTGGAATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152460
C17orf77 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 77
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152460.2-1452s21c1
Sequence:CCGGTCCAATCCTTGGATCAAATATCTCGAGATATTTGATCCAAGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152460.2-1006s21c1
Sequence:CCGGCCACTGTAAGACATCTCATTGCTCGAGCAATGAGATGTCTTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152460.2-1338s21c1
Sequence:CCGGCCCTCCTGAATCGATTCATTTCTCGAGAAATGAATCGATTCAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-650s1c1
Sequence:CCGGCATCTGTAGCTACTTCTCTTTCTCGAGAAAGAGAAGTAGCTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-392s1c1
Sequence:CCGGGACATGTCTCCTTCCTGAGAACTCGAGTTCTCAGGAAGGAGACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-578s1c1
Sequence:CCGGGAATCCAAGCTCGGAAGTCAACTCGAGTTGACTTCCGAGCTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-632s1c1
Sequence:CCGGCTTGCTCACTTCCTGTTACATCTCGAGATGTAACAGGAAGTGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-628s1c1
Sequence:CCGGGTCTCTTGCTCACTTCCTGTTCTCGAGAACAGGAAGTGAGCAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-573s1c1
Sequence:CCGGGACTTGAATCCAAGCTCGGAACTCGAGTTCCGAGCTTGGATTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152460.1-440s1c1
Sequence:CCGGGCTGTCATTCCAGTGCCTTAACTCGAGTTAAGGCACTGGAATGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks