EMAIL THIS PAGE TO A FRIEND

C17orf78

chromosome 17 open reading frame 78

53 Gene Product Result for
UniProtKB ID: Q8N4C9, Q8N8D2
Gene ID:
chicken(417655) chromosome 19 open reading frame, human C17orf78
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173625 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100491 MISSION® esiRNA esiRNA human C17orf78 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173625 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213163 predicted 949
2 SASI_Hs01_00213164 predicted 581
3 SASI_Hs01_00213166 predicted 641
4 SASI_Hs01_00213167 predicted 402
5 SASI_Hs01_00213168 predicted 897
6 SASI_Hs01_00213169 predicted 815
7 SASI_Hs02_00368503 predicted 809
8 SASI_Hs01_00213170 predicted 298
9 SASI_Hs01_00213172 predicted 558
10 SASI_Hs02_00368504 predicted 934
11 SASI_Hs01_00213165 predicted 963
12 SASI_Hs01_00213171 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173625
C17orf78 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 78
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173625.3-511s1c1
Sequence:CCGGCTTCTATAACTCCTGGGAATACTCGAGTATTCCCAGGAGTTATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-887s1c1
Sequence:CCGGGCTCTATCTCAAAGACTGAATCTCGAGATTCAGTCTTTGAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-1610s1c1
Sequence:CCGGGAGTCAAATCTAACCTGCTTACTCGAGTAAGCAGGTTAGATTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-587s1c1
Sequence:CCGGGAAATGGAGTATTGTGGTCAACTCGAGTTGACCACAATACTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-1067s1c1
Sequence:CCGGCCTTCTGTAATTCACTTCATACTCGAGTATGAAGTGAATTACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173625.3-403s1c1
Sequence:CCGGCATCCAAGTTTCAGACTGGATCTCGAGATCCAGTCTGAAACTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173625.3-1584s1c1
Sequence:CCGGGCTGTTTCTCACAGGAGAATACTCGAGTATTCTCCTGTGAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-813s1c1
Sequence:CCGGGCTGCCAATTCATCAAACCCACTCGAGTGGGTTTGATGAATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-307s1c1
Sequence:CCGGGAAGGCCAAAGGTCAAGCATACTCGAGTATGCTTGACCTTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-560s1c1
Sequence:CCGGCACAGATGAGAACCTAGAGAACTCGAGTTCTCTAGGTTCTCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173625
C17orf78 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 78
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173625.3-511s1c1
Sequence:CCGGCTTCTATAACTCCTGGGAATACTCGAGTATTCCCAGGAGTTATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-887s1c1
Sequence:CCGGGCTCTATCTCAAAGACTGAATCTCGAGATTCAGTCTTTGAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-1610s1c1
Sequence:CCGGGAGTCAAATCTAACCTGCTTACTCGAGTAAGCAGGTTAGATTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-587s1c1
Sequence:CCGGGAAATGGAGTATTGTGGTCAACTCGAGTTGACCACAATACTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-1067s1c1
Sequence:CCGGCCTTCTGTAATTCACTTCATACTCGAGTATGAAGTGAATTACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173625.3-403s1c1
Sequence:CCGGCATCCAAGTTTCAGACTGGATCTCGAGATCCAGTCTGAAACTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173625.3-1584s1c1
Sequence:CCGGGCTGTTTCTCACAGGAGAATACTCGAGTATTCTCCTGTGAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-813s1c1
Sequence:CCGGGCTGCCAATTCATCAAACCCACTCGAGTGGGTTTGATGAATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-307s1c1
Sequence:CCGGGAAGGCCAAAGGTCAAGCATACTCGAGTATGCTTGACCTTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-560s1c1
Sequence:CCGGCACAGATGAGAACCTAGAGAACTCGAGTTCTCTAGGTTCTCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173625
C17orf78 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 78
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173625.3-511s1c1
Sequence:CCGGCTTCTATAACTCCTGGGAATACTCGAGTATTCCCAGGAGTTATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-887s1c1
Sequence:CCGGGCTCTATCTCAAAGACTGAATCTCGAGATTCAGTCTTTGAGATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-1610s1c1
Sequence:CCGGGAGTCAAATCTAACCTGCTTACTCGAGTAAGCAGGTTAGATTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-587s1c1
Sequence:CCGGGAAATGGAGTATTGTGGTCAACTCGAGTTGACCACAATACTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173625.3-1067s1c1
Sequence:CCGGCCTTCTGTAATTCACTTCATACTCGAGTATGAAGTGAATTACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173625.3-403s1c1
Sequence:CCGGCATCCAAGTTTCAGACTGGATCTCGAGATCCAGTCTGAAACTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173625.3-1584s1c1
Sequence:CCGGGCTGTTTCTCACAGGAGAATACTCGAGTATTCTCCTGTGAGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-813s1c1
Sequence:CCGGGCTGCCAATTCATCAAACCCACTCGAGTGGGTTTGATGAATTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-307s1c1
Sequence:CCGGGAAGGCCAAAGGTCAAGCATACTCGAGTATGCTTGACCTTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173625.3-560s1c1
Sequence:CCGGCACAGATGAGAACCTAGAGAACTCGAGTTCTCTAGGTTCTCATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks