EMAIL THIS PAGE TO A FRIEND

C17orf80

chromosome 17 open reading frame 80

44 Gene Product Result for
Synonyms: HLC-8 MIG3 SPEP1
Gene ID:
chicken(417451) chromosome 18 open reading frame, human C17orf80
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012896 Anti-C17orf80 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100260 Anti-C17ORF80 antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, rat, horse, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017941 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072551 MISSION® esiRNA esiRNA human C17orf80 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100621 Rosetta Predictions human pricing
NM_001100622 Rosetta Predictions human pricing
NM_017941 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322274 predicted 502
2 SASI_Hs02_00322275 predicted 423
3 SASI_Hs02_00322276 predicted 644
4 SASI_Hs02_00322277 predicted 665
5 SASI_Hs02_00322278 predicted 992
6 SASI_Hs02_00322279 predicted 983
7 SASI_Hs02_00322280 predicted 1324
8 SASI_Hs02_00322281 predicted 1413
9 SASI_Hs02_00322282 predicted 1365
10 SASI_Hs02_00322283 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322284 predicted 503
2 SASI_Hs02_00322285 predicted 429
3 SASI_Hs02_00322286 predicted 643
4 SASI_Hs02_00322287 predicted 669
5 SASI_Hs02_00322288 predicted 992
6 SASI_Hs02_00322289 predicted 981
7 SASI_Hs02_00322290 predicted 1328
8 SASI_Hs02_00322291 predicted 1414
9 SASI_Hs02_00322292 predicted 1367
10 SASI_Hs02_00322293 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045139 predicted 496
2 SASI_Hs01_00045141 predicted 423
3 SASI_Hs01_00045142 predicted 644
4 SASI_Hs01_00045143 predicted 666
5 SASI_Hs01_00045147 predicted 984
6 SASI_Hs02_00350950 predicted 985
7 SASI_Hs02_00350951 predicted 1327
8 SASI_Hs02_00350952 predicted 1414
9 SASI_Hs02_00350953 predicted 1365
10 SASI_Hs02_00350954 predicted 1084
11 SASI_Hs01_00045140 predicted 1871
12 SASI_Hs01_00045144 predicted 1686
13 SASI_Hs01_00045145 predicted 1647
14 SASI_Hs01_00045146 predicted 1890
15 SASI_Hs01_00045148 predicted 1786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017941
VALIDATED
C17orf80 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 80
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-911s1c1
Sequence:CCGGCAGTTACTGAGACTCCAGAAACTCGAGTTTCTGGAGTCTCAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-496s1c1
Sequence:CCGGCCAATGACTACTTTCCAAGAACTCGAGTTCTTGGAAAGTAGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017941.3-1303s1c1
Sequence:CCGGGTCCCTGATGTAAAGGCATTACTCGAGTAATGCCTTTACATCAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017941.3-649s1c1
Sequence:CCGGGAACCTTCTTTGTCAAATCAACTCGAGTTGATTTGACAAAGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017941.3-1951s1c1
Sequence:CCGGCGTTTAAGTAGGAGAAGCCTTCTCGAGAAGGCTTCTCCTACTTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017941.3-149s1c1
Sequence:CCGGCTTACTGTAAGAAGCCATTTACTCGAGTAAATGGCTTCTTACAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-1199s1c1
Sequence:CCGGCTTACCAGTTTCATTCTGTATCTCGAGATACAGAATGAAACTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-333s21c1
Sequence:CCGGGCTACACTCCCACGTGCTAAACTCGAGTTTAGCACGTGGGAGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2191s21c1
Sequence:CCGGAGTAGTATCACTTGTCATAATCTCGAGATTATGACAAGTGATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-694s21c1
Sequence:CCGGCAGAAGCTGGAGCGTCTTTACCTCGAGGTAAAGACGCTCCAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-1323s21c1
Sequence:CCGGGCCTCTCTAGCTACAACATTTCTCGAGAAATGTTGTAGCTAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-1719s21c1
Sequence:CCGGGAACGAAGCTCAACTCATATACTCGAGTATATGAGTTGAGCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2112s21c1
Sequence:CCGGTAAGTGTAGTGGTAGCATTAACTCGAGTTAATGCTACCACTACACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2479s21c1
Sequence:CCGGAGATACTGAGAATCCACAATACTCGAGTATTGTGGATTCTCAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017941
VALIDATED
C17orf80 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 80
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-911s1c1
Sequence:CCGGCAGTTACTGAGACTCCAGAAACTCGAGTTTCTGGAGTCTCAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-496s1c1
Sequence:CCGGCCAATGACTACTTTCCAAGAACTCGAGTTCTTGGAAAGTAGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017941.3-1303s1c1
Sequence:CCGGGTCCCTGATGTAAAGGCATTACTCGAGTAATGCCTTTACATCAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017941.3-649s1c1
Sequence:CCGGGAACCTTCTTTGTCAAATCAACTCGAGTTGATTTGACAAAGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017941.3-1951s1c1
Sequence:CCGGCGTTTAAGTAGGAGAAGCCTTCTCGAGAAGGCTTCTCCTACTTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017941.3-149s1c1
Sequence:CCGGCTTACTGTAAGAAGCCATTTACTCGAGTAAATGGCTTCTTACAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-1199s1c1
Sequence:CCGGCTTACCAGTTTCATTCTGTATCTCGAGATACAGAATGAAACTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-333s21c1
Sequence:CCGGGCTACACTCCCACGTGCTAAACTCGAGTTTAGCACGTGGGAGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2191s21c1
Sequence:CCGGAGTAGTATCACTTGTCATAATCTCGAGATTATGACAAGTGATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-694s21c1
Sequence:CCGGCAGAAGCTGGAGCGTCTTTACCTCGAGGTAAAGACGCTCCAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-1323s21c1
Sequence:CCGGGCCTCTCTAGCTACAACATTTCTCGAGAAATGTTGTAGCTAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-1719s21c1
Sequence:CCGGGAACGAAGCTCAACTCATATACTCGAGTATATGAGTTGAGCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2112s21c1
Sequence:CCGGTAAGTGTAGTGGTAGCATTAACTCGAGTTAATGCTACCACTACACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2479s21c1
Sequence:CCGGAGATACTGAGAATCCACAATACTCGAGTATTGTGGATTCTCAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017941
VALIDATED
C17orf80 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 80
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-911s1c1
Sequence:CCGGCAGTTACTGAGACTCCAGAAACTCGAGTTTCTGGAGTCTCAGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-496s1c1
Sequence:CCGGCCAATGACTACTTTCCAAGAACTCGAGTTCTTGGAAAGTAGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017941.3-1303s1c1
Sequence:CCGGGTCCCTGATGTAAAGGCATTACTCGAGTAATGCCTTTACATCAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017941.3-649s1c1
Sequence:CCGGGAACCTTCTTTGTCAAATCAACTCGAGTTGATTTGACAAAGAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017941.3-1951s1c1
Sequence:CCGGCGTTTAAGTAGGAGAAGCCTTCTCGAGAAGGCTTCTCCTACTTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017941.3-149s1c1
Sequence:CCGGCTTACTGTAAGAAGCCATTTACTCGAGTAAATGGCTTCTTACAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017941.3-1199s1c1
Sequence:CCGGCTTACCAGTTTCATTCTGTATCTCGAGATACAGAATGAAACTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-333s21c1
Sequence:CCGGGCTACACTCCCACGTGCTAAACTCGAGTTTAGCACGTGGGAGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2191s21c1
Sequence:CCGGAGTAGTATCACTTGTCATAATCTCGAGATTATGACAAGTGATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-694s21c1
Sequence:CCGGCAGAAGCTGGAGCGTCTTTACCTCGAGGTAAAGACGCTCCAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-1323s21c1
Sequence:CCGGGCCTCTCTAGCTACAACATTTCTCGAGAAATGTTGTAGCTAGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017941.4-1719s21c1
Sequence:CCGGGAACGAAGCTCAACTCATATACTCGAGTATATGAGTTGAGCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2112s21c1
Sequence:CCGGTAAGTGTAGTGGTAGCATTAACTCGAGTTAATGCTACCACTACACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017941.4-2479s21c1
Sequence:CCGGAGATACTGAGAATCCACAATACTCGAGTATTGTGGATTCTCAGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks