EMAIL THIS PAGE TO A FRIEND

C17orf82

chromosome 17 open reading frame 82

Species: Human C17orf82(388407)
UniProtKB ID: Q86X59
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203425 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203425 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134020 predicted 595
2 SASI_Hs01_00134021 predicted 1106
3 SASI_Hs01_00134022 predicted 632
4 SASI_Hs01_00134023 predicted 839
5 SASI_Hs01_00134024 predicted 973
6 SASI_Hs01_00134025 predicted 661
7 SASI_Hs01_00134026 predicted 525
8 SASI_Hs01_00134027 predicted 505
9 SASI_Hs01_00134028 predicted 670
10 SASI_Hs01_00134029 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203425
C17orf82 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 82
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-251s21c1
Sequence:CCGGCTCTACGAGCCCTGGATTTATCTCGAGATAAATCCAGGGCTCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-680s21c1
Sequence:CCGGGGTTTCCCAGCGAGTCCTCTTCTCGAGAAGAGGACTCGCTGGGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-595s21c1
Sequence:CCGGGCATATCTGTTCCTCCTATTGCTCGAGCAATAGGAGGAACAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-639s21c1
Sequence:CCGGCACTCCGGAAGCACCGATTTCCTCGAGGAAATCGGTGCTTCCGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203425.1-1231s21c1
Sequence:CCGGCACTCGACGGTGAGGACTTACCTCGAGGTAAGTCCTCACCGTCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203425
C17orf82 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 82
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-251s21c1
Sequence:CCGGCTCTACGAGCCCTGGATTTATCTCGAGATAAATCCAGGGCTCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-680s21c1
Sequence:CCGGGGTTTCCCAGCGAGTCCTCTTCTCGAGAAGAGGACTCGCTGGGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-595s21c1
Sequence:CCGGGCATATCTGTTCCTCCTATTGCTCGAGCAATAGGAGGAACAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-639s21c1
Sequence:CCGGCACTCCGGAAGCACCGATTTCCTCGAGGAAATCGGTGCTTCCGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203425.1-1231s21c1
Sequence:CCGGCACTCGACGGTGAGGACTTACCTCGAGGTAAGTCCTCACCGTCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203425
C17orf82 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 82
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-251s21c1
Sequence:CCGGCTCTACGAGCCCTGGATTTATCTCGAGATAAATCCAGGGCTCGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-680s21c1
Sequence:CCGGGGTTTCCCAGCGAGTCCTCTTCTCGAGAAGAGGACTCGCTGGGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-595s21c1
Sequence:CCGGGCATATCTGTTCCTCCTATTGCTCGAGCAATAGGAGGAACAGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203425.1-639s21c1
Sequence:CCGGCACTCCGGAAGCACCGATTTCCTCGAGGAAATCGGTGCTTCCGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203425.1-1231s21c1
Sequence:CCGGCACTCGACGGTGAGGACTTACCTCGAGGTAAGTCCTCACCGTCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks