EMAIL THIS PAGE TO A FRIEND

C17orf85

chromosome 17 open reading frame 85

Synonyms: ELG HSA277841
Species: Human C17orf85(55421)
UniProtKB ID: Q53F19, B3KWG7, Q7L406, Q96FK1, Q9NXZ4
Gene ID:
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018553 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083321 MISSION® esiRNA esiRNA human C17orf85 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114118 Rosetta Predictions human pricing
NM_018553 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326284 predicted 1776
2 SASI_Hs02_00326285 predicted 1378
3 SASI_Hs02_00326286 predicted 1820
4 SASI_Hs02_00326287 predicted 1341
5 SASI_Hs02_00326288 predicted 1559
6 SASI_Hs02_00326289 predicted 1382
7 SASI_Hs02_00326290 predicted 503
8 SASI_Hs02_00326291 predicted 1396
9 SASI_Hs02_00326292 predicted 1834
10 SASI_Hs02_00326293 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145843 predicted 1811
2 SASI_Hs01_00145844 predicted 1409
3 SASI_Hs01_00145845 predicted 1849
4 SASI_Hs01_00145847 predicted 1380
5 SASI_Hs02_00352102 predicted 1593
6 SASI_Hs02_00352103 predicted 2260
7 SASI_Hs01_00145849 predicted 1420
8 SASI_Hs01_00145850 predicted 2335
9 SASI_Hs01_00145851 predicted 1429
10 SASI_Hs01_00145852 predicted 1862
11 SASI_Hs01_00145846 predicted 1545
12 SASI_Hs01_00145848 predicted 1219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018553
C17orf85 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 85
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-1373s21c1
Sequence:CCGGCATGAGGGCAGATAGTGTATCCTCGAGGATACACTATCTGCCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-960s21c1
Sequence:CCGGAGATATCATTCCCGTCGTATTCTCGAGAATACGACGGGAATGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-1629s21c1
Sequence:CCGGGTTCCCAGGCAGGATAGTAAACTCGAGTTTACTATCCTGCCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018553.3-2051s21c1
Sequence:CCGGTACTTCGGCAAGACATCTTAACTCGAGTTAAGATGTCTTGCCGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-302s1c1
Sequence:CCGGCGTCGTATAAACATCGACATTCTCGAGAATGTCGATGTTTATACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-869s1c1
Sequence:CCGGCCTCTTCTGATGTGCATAGTACTCGAGTACTATGCACATCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-937s1c1
Sequence:CCGGCGGGAGAAGAAATCAGGTAATCTCGAGATTACCTGATTTCTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-724s1c1
Sequence:CCGGCGACATCTATTAGATGAGAAACTCGAGTTTCTCATCTAATAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-1112s1c1
Sequence:CCGGGCCGGTTAGATAACTTACCATCTCGAGATGGTAAGTTATCTAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018553
C17orf85 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 85
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-1373s21c1
Sequence:CCGGCATGAGGGCAGATAGTGTATCCTCGAGGATACACTATCTGCCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-960s21c1
Sequence:CCGGAGATATCATTCCCGTCGTATTCTCGAGAATACGACGGGAATGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-1629s21c1
Sequence:CCGGGTTCCCAGGCAGGATAGTAAACTCGAGTTTACTATCCTGCCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018553.3-2051s21c1
Sequence:CCGGTACTTCGGCAAGACATCTTAACTCGAGTTAAGATGTCTTGCCGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-302s1c1
Sequence:CCGGCGTCGTATAAACATCGACATTCTCGAGAATGTCGATGTTTATACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-869s1c1
Sequence:CCGGCCTCTTCTGATGTGCATAGTACTCGAGTACTATGCACATCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-937s1c1
Sequence:CCGGCGGGAGAAGAAATCAGGTAATCTCGAGATTACCTGATTTCTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-724s1c1
Sequence:CCGGCGACATCTATTAGATGAGAAACTCGAGTTTCTCATCTAATAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-1112s1c1
Sequence:CCGGGCCGGTTAGATAACTTACCATCTCGAGATGGTAAGTTATCTAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018553
C17orf85 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 85
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-1373s21c1
Sequence:CCGGCATGAGGGCAGATAGTGTATCCTCGAGGATACACTATCTGCCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-960s21c1
Sequence:CCGGAGATATCATTCCCGTCGTATTCTCGAGAATACGACGGGAATGATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018553.3-1629s21c1
Sequence:CCGGGTTCCCAGGCAGGATAGTAAACTCGAGTTTACTATCCTGCCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018553.3-2051s21c1
Sequence:CCGGTACTTCGGCAAGACATCTTAACTCGAGTTAAGATGTCTTGCCGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-302s1c1
Sequence:CCGGCGTCGTATAAACATCGACATTCTCGAGAATGTCGATGTTTATACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-869s1c1
Sequence:CCGGCCTCTTCTGATGTGCATAGTACTCGAGTACTATGCACATCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-937s1c1
Sequence:CCGGCGGGAGAAGAAATCAGGTAATCTCGAGATTACCTGATTTCTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-724s1c1
Sequence:CCGGCGACATCTATTAGATGAGAAACTCGAGTTTCTCATCTAATAGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018553.1-1112s1c1
Sequence:CCGGGCCGGTTAGATAACTTACCATCTCGAGATGGTAAGTTATCTAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks