EMAIL THIS PAGE TO A FRIEND

C17orf89

chromosome 17 open reading frame 89

45 Gene Product Result for
Species: Human C17orf89(284184)
UniProtKB ID: A1L188
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057732 Anti-C17orf89 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001086521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001086521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001086521 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225451 MISSION® esiRNA esiRNA targeting human C17orf89 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001086521 Rosetta Predictions human pricing
XM_211367 Rosetta Predictions human pricing
XM_934620 Rosetta Predictions human pricing
XM_934621 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001086521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318006 predicted 265
2 SASI_Hs02_00318007 predicted 278
3 SASI_Hs02_00318008 predicted 264
4 SASI_Hs02_00318009 predicted 305
5 SASI_Hs02_00318010 predicted 255
6 SASI_Hs02_00318011 predicted 256
7 SASI_Hs02_00318012 predicted 273
8 SASI_Hs02_00318013 predicted 271
9 SASI_Hs02_00318014 predicted 251
10 SASI_Hs02_00318015 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_211367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283449 predicted 599
2 SASI_Hs01_00283450 predicted 612
3 SASI_Hs01_00283451 predicted 602
4 SASI_Hs01_00283452 predicted 649
5 SASI_Hs01_00283453 predicted 584
6 SASI_Hs01_00283454 predicted 589
7 SASI_Hs01_00283455 predicted 613
8 SASI_Hs01_00283456 predicted 613
9 SASI_Hs01_00283457 predicted 589
10 SASI_Hs01_00283458 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290613 predicted 248
2 SASI_Hs01_00290614 predicted 518
3 SASI_Hs01_00290615 predicted 475
4 SASI_Hs01_00290616 predicted 337
5 SASI_Hs01_00290617 predicted 377
6 SASI_Hs01_00290618 predicted 251
7 SASI_Hs01_00290619 predicted 321
8 SASI_Hs01_00290620 predicted 447
9 SASI_Hs01_00290621 predicted 340
10 SASI_Hs01_00290622 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286266 predicted 239
2 SASI_Hs01_00286267 predicted 243
3 SASI_Hs01_00286268 predicted 340
4 SASI_Hs01_00286269 predicted 379
5 SASI_Hs01_00286270 predicted 252
6 SASI_Hs01_00286271 predicted 320
7 SASI_Hs01_00286272 predicted 341
8 SASI_Hs01_00286273 predicted 325
9 SASI_Hs01_00286274 predicted 352
10 SASI_Hs01_00286275 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001086521
C17orf89 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 89
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-355s21c1
Sequence:CCGGTCGAATGCCTAGGGCAGAAAGCTCGAGCTTTCTGCCCTAGGCATTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-316s21c1
Sequence:CCGGGTGCAGAGCCCTAGTCCTGATCTCGAGATCAGGACTAGGGCTCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-286s21c1
Sequence:CCGGTCTGAGCTTCACACCTGTCTGCTCGAGCAGACAGGTGTGAAGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001086521.1-184s21c1
Sequence:CCGGGCCGCCTGAGTAAGGACTTCTCTCGAGAGAAGTCCTTACTCAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-382s21c1
Sequence:CCGGGGAATGGCGAAGATGTGACATCTCGAGATGTCACATCTTCGCCATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001086521
C17orf89 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 89
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-355s21c1
Sequence:CCGGTCGAATGCCTAGGGCAGAAAGCTCGAGCTTTCTGCCCTAGGCATTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-316s21c1
Sequence:CCGGGTGCAGAGCCCTAGTCCTGATCTCGAGATCAGGACTAGGGCTCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-286s21c1
Sequence:CCGGTCTGAGCTTCACACCTGTCTGCTCGAGCAGACAGGTGTGAAGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001086521.1-184s21c1
Sequence:CCGGGCCGCCTGAGTAAGGACTTCTCTCGAGAGAAGTCCTTACTCAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-382s21c1
Sequence:CCGGGGAATGGCGAAGATGTGACATCTCGAGATGTCACATCTTCGCCATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001086521
C17orf89 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 89
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-355s21c1
Sequence:CCGGTCGAATGCCTAGGGCAGAAAGCTCGAGCTTTCTGCCCTAGGCATTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-316s21c1
Sequence:CCGGGTGCAGAGCCCTAGTCCTGATCTCGAGATCAGGACTAGGGCTCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-286s21c1
Sequence:CCGGTCTGAGCTTCACACCTGTCTGCTCGAGCAGACAGGTGTGAAGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001086521.1-184s21c1
Sequence:CCGGGCCGCCTGAGTAAGGACTTCTCTCGAGAGAAGTCCTTACTCAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001086521.1-382s21c1
Sequence:CCGGGGAATGGCGAAGATGTGACATCTCGAGATGTCACATCTTCGCCATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)