EMAIL THIS PAGE TO A FRIEND

C17orf96

chromosome 17 open reading frame 96

8 Gene Product Result for
Species: Human C17orf96(100170841)
UniProtKB ID: A6NHQ4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130677
C17orf96 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 96
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1060s21c1
Sequence:CCGGGCCTGCCGAAGTCGATGGAAACTCGAGTTTCCATCGACTTCGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-877s21c1
Sequence:CCGGTCGGGAATCTACGACCAGCTTCTCGAGAAGCTGGTCGTAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1190s21c1
Sequence:CCGGCGGTCGAAACTTTGGTGTTACCTCGAGGTAACACCAAAGTTTCGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1223s21c1
Sequence:CCGGGCCTTGGACACTCCGAGTTTGCTCGAGCAAACTCGGAGTGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1153s21c1
Sequence:CCGGAGATCTCCGCCAGGAACATTTCTCGAGAAATGTTCCTGGCGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1570s21c1
Sequence:CCGGTGAAAGCTGACCGTGGGACTTCTCGAGAAGTCCCACGGTCAGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130677.1-1946s21c1
Sequence:CCGGGATGGACAAACCGGTTGTTACCTCGAGGTAACAACCGGTTTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1455s21c1
Sequence:CCGGTTCGCCTCCAGGGAGACTCTACTCGAGTAGAGTCTCCCTGGAGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130677
C17orf96 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 96
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1060s21c1
Sequence:CCGGGCCTGCCGAAGTCGATGGAAACTCGAGTTTCCATCGACTTCGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-877s21c1
Sequence:CCGGTCGGGAATCTACGACCAGCTTCTCGAGAAGCTGGTCGTAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1190s21c1
Sequence:CCGGCGGTCGAAACTTTGGTGTTACCTCGAGGTAACACCAAAGTTTCGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1223s21c1
Sequence:CCGGGCCTTGGACACTCCGAGTTTGCTCGAGCAAACTCGGAGTGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1153s21c1
Sequence:CCGGAGATCTCCGCCAGGAACATTTCTCGAGAAATGTTCCTGGCGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1570s21c1
Sequence:CCGGTGAAAGCTGACCGTGGGACTTCTCGAGAAGTCCCACGGTCAGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130677.1-1946s21c1
Sequence:CCGGGATGGACAAACCGGTTGTTACCTCGAGGTAACAACCGGTTTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1455s21c1
Sequence:CCGGTTCGCCTCCAGGGAGACTCTACTCGAGTAGAGTCTCCCTGGAGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130677
C17orf96 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 96
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1060s21c1
Sequence:CCGGGCCTGCCGAAGTCGATGGAAACTCGAGTTTCCATCGACTTCGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-877s21c1
Sequence:CCGGTCGGGAATCTACGACCAGCTTCTCGAGAAGCTGGTCGTAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1190s21c1
Sequence:CCGGCGGTCGAAACTTTGGTGTTACCTCGAGGTAACACCAAAGTTTCGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1223s21c1
Sequence:CCGGGCCTTGGACACTCCGAGTTTGCTCGAGCAAACTCGGAGTGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1153s21c1
Sequence:CCGGAGATCTCCGCCAGGAACATTTCTCGAGAAATGTTCCTGGCGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1570s21c1
Sequence:CCGGTGAAAGCTGACCGTGGGACTTCTCGAGAAGTCCCACGGTCAGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130677.1-1946s21c1
Sequence:CCGGGATGGACAAACCGGTTGTTACCTCGAGGTAACAACCGGTTTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130677.1-1455s21c1
Sequence:CCGGTTCGCCTCCAGGGAGACTCTACTCGAGTAGAGTCTCCCTGGAGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks