EMAIL THIS PAGE TO A FRIEND

C17orf97

chromosome 17 open reading frame 97

16 Gene Product Result for
Species: Human C17orf97(400566)
UniProtKB ID: Q6ZQX7, A5D8T6, Q6NSI2, Q6PFW9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023583 Anti-C17orf97 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV54431 Anti-LOC400566 antibody produced in rabbit affinity isolated antibody canine, rabbit, human, horse, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013672 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013672 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165576 predicted 1277
2 SASI_Hs01_00165577 predicted 1359
3 SASI_Hs01_00165578 predicted 1560
4 SASI_Hs01_00165581 predicted 567
5 SASI_Hs02_00306448 predicted 1286
6 SASI_Hs01_00165580 predicted 883
7 SASI_Hs01_00165582 predicted 1356
8 SASI_Hs01_00165583 predicted 573
9 SASI_Hs01_00165585 predicted 1355
10 SASI_Hs01_00165584 predicted 880
11 SASI_Hs01_00165579 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013672
VALIDATED
C17orf97 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 97
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013672.4-1299s21c1
Sequence:CCGGACGACGCTCACAAACTTATAACTCGAGTTATAAGTTTGTGAGCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013672.4-1530s21c1
Sequence:CCGGAGCATCTCTGTTACTTAATTTCTCGAGAAATTAAGTAACAGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-554s1c1
Sequence:CCGGGAGGCAGAGAAGGAAAGGATTCTCGAGAATCCTTTCCTTCTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-258s1c1
Sequence:CCGGCCAAACGGAAGGTGAAGAAGACTCGAGTCTTCTTCACCTTCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013672.2-1230s1c1
Sequence:CCGGCTGAGAACTTACCCTACCTCTCTCGAGAGAGGTAGGGTAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013672.2-478s1c1
Sequence:CCGGCGACTTTGCCGAAATAGAGAACTCGAGTTCTCTATTTCGGCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-1467s1c1
Sequence:CCGGCCGTATCTGAAGGAAACAGATCTCGAGATCTGTTTCCTTCAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013672.2-363s1c1
Sequence:CCGGCCTCCTTTCATGACATCTTAACTCGAGTTAAGATGTCATGAAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013672.2-488s1c1
Sequence:CCGGGAAATAGAGAACCTTGCGAATCTCGAGATTCGCAAGGTTCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013672
VALIDATED
C17orf97 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 97
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013672.4-1299s21c1
Sequence:CCGGACGACGCTCACAAACTTATAACTCGAGTTATAAGTTTGTGAGCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013672.4-1530s21c1
Sequence:CCGGAGCATCTCTGTTACTTAATTTCTCGAGAAATTAAGTAACAGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-554s1c1
Sequence:CCGGGAGGCAGAGAAGGAAAGGATTCTCGAGAATCCTTTCCTTCTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-258s1c1
Sequence:CCGGCCAAACGGAAGGTGAAGAAGACTCGAGTCTTCTTCACCTTCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013672.2-1230s1c1
Sequence:CCGGCTGAGAACTTACCCTACCTCTCTCGAGAGAGGTAGGGTAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013672.2-478s1c1
Sequence:CCGGCGACTTTGCCGAAATAGAGAACTCGAGTTCTCTATTTCGGCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-1467s1c1
Sequence:CCGGCCGTATCTGAAGGAAACAGATCTCGAGATCTGTTTCCTTCAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013672.2-363s1c1
Sequence:CCGGCCTCCTTTCATGACATCTTAACTCGAGTTAAGATGTCATGAAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013672.2-488s1c1
Sequence:CCGGGAAATAGAGAACCTTGCGAATCTCGAGATTCGCAAGGTTCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013672
VALIDATED
C17orf97 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 97
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013672.4-1299s21c1
Sequence:CCGGACGACGCTCACAAACTTATAACTCGAGTTATAAGTTTGTGAGCGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013672.4-1530s21c1
Sequence:CCGGAGCATCTCTGTTACTTAATTTCTCGAGAAATTAAGTAACAGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-554s1c1
Sequence:CCGGGAGGCAGAGAAGGAAAGGATTCTCGAGAATCCTTTCCTTCTCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-258s1c1
Sequence:CCGGCCAAACGGAAGGTGAAGAAGACTCGAGTCTTCTTCACCTTCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013672.2-1230s1c1
Sequence:CCGGCTGAGAACTTACCCTACCTCTCTCGAGAGAGGTAGGGTAAGTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013672.2-478s1c1
Sequence:CCGGCGACTTTGCCGAAATAGAGAACTCGAGTTCTCTATTTCGGCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013672.2-1467s1c1
Sequence:CCGGCCGTATCTGAAGGAAACAGATCTCGAGATCTGTTTCCTTCAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013672.2-363s1c1
Sequence:CCGGCCTCCTTTCATGACATCTTAACTCGAGTTAAGATGTCATGAAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013672.2-488s1c1
Sequence:CCGGGAAATAGAGAACCTTGCGAATCTCGAGATTCGCAAGGTTCTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks