EMAIL THIS PAGE TO A FRIEND

C17orf98

chromosome 17 open reading frame 98

27 Gene Product Result for
Species: Human C17orf98(388381)
UniProtKB ID: A8MV24
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080465 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221391 MISSION® esiRNA esiRNA targeting human C17orf98 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080465 Rosetta Predictions human pricing
XM_371053 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315096 predicted 337
2 SASI_Hs02_00315097 predicted 266
3 SASI_Hs02_00315098 predicted 198
4 SASI_Hs02_00315099 predicted 208
5 SASI_Hs02_00315100 predicted 331
6 SASI_Hs02_00315101 predicted 217
7 SASI_Hs02_00315102 predicted 230
8 SASI_Hs02_00315103 predicted 338
9 SASI_Hs02_00315104 predicted 258
10 SASI_Hs02_00315105 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267468 predicted 235
2 SASI_Hs01_00267469 predicted 211
3 SASI_Hs01_00267470 predicted 210
4 SASI_Hs01_00267471 predicted 224
5 SASI_Hs01_00267472 predicted 224
6 SASI_Hs01_00267473 predicted 227
7 SASI_Hs01_00267474 predicted 227
8 SASI_Hs01_00267475 predicted 196
9 SASI_Hs01_00267476 predicted 223
10 SASI_Hs01_00267477 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080465
C17orf98 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 98
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-202s21c1
Sequence:CCGGGATCAGGATCATGGCGGTACACTCGAGTGTACCGCCATGATCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-259s21c1
Sequence:CCGGTTCGGGCAAGGACAAAGATACCTCGAGGTATCTTTGTCCTTGCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-27s21c1
Sequence:CCGGGCGACTGGAGAAAGGCTTTATCTCGAGATAAAGCCTTTCTCCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-329s21c1
Sequence:CCGGCTGGGCATGACCACTACAATGCTCGAGCATTGTAGTGGTCATGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080465
C17orf98 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 98
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-202s21c1
Sequence:CCGGGATCAGGATCATGGCGGTACACTCGAGTGTACCGCCATGATCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-259s21c1
Sequence:CCGGTTCGGGCAAGGACAAAGATACCTCGAGGTATCTTTGTCCTTGCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-27s21c1
Sequence:CCGGGCGACTGGAGAAAGGCTTTATCTCGAGATAAAGCCTTTCTCCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-329s21c1
Sequence:CCGGCTGGGCATGACCACTACAATGCTCGAGCATTGTAGTGGTCATGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080465
C17orf98 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 98
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-202s21c1
Sequence:CCGGGATCAGGATCATGGCGGTACACTCGAGTGTACCGCCATGATCCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-259s21c1
Sequence:CCGGTTCGGGCAAGGACAAAGATACCTCGAGGTATCTTTGTCCTTGCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-27s21c1
Sequence:CCGGGCGACTGGAGAAAGGCTTTATCTCGAGATAAAGCCTTTCTCCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080465.2-329s21c1
Sequence:CCGGCTGGGCATGACCACTACAATGCTCGAGCATTGTAGTGGTCATGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks