EMAIL THIS PAGE TO A FRIEND

C17orf99

chromosome 17 open reading frame 99

6 Gene Product Result for
Species: Human C17orf99(100141515)
UniProtKB ID: Q6UX52
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001163075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001163075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163075
C17orf99 MISSION shRNA Bacterial Glycerol Stock
chromosome 17 open reading frame 99
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-642s21c1
Sequence:CCGGAGGCTGCAAACAACGCCAATGCTCGAGCATTGGCGTTGTTTGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-331s21c1
Sequence:CCGGTCCAGACCTGCTCACCTACTTCTCGAGAAGTAGGTGAGCAGGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-138s21c1
Sequence:CCGGTGGTCTCCATTGCCTACAAAGCTCGAGCTTTGTAGGCAATGGAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-832s21c1
Sequence:CCGGACGCAAAGCAGCAGCCATGTACTCGAGTACATGGCTGCTGCTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163075.1-900s21c1
Sequence:CCGGCAGCGTGCACTGTTCGTATTTCTCGAGAAATACGAACAGTGCACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163075
C17orf99 MISSION shRNA shRNA Plasmid DNA
chromosome 17 open reading frame 99
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-642s21c1
Sequence:CCGGAGGCTGCAAACAACGCCAATGCTCGAGCATTGGCGTTGTTTGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-331s21c1
Sequence:CCGGTCCAGACCTGCTCACCTACTTCTCGAGAAGTAGGTGAGCAGGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-138s21c1
Sequence:CCGGTGGTCTCCATTGCCTACAAAGCTCGAGCTTTGTAGGCAATGGAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-832s21c1
Sequence:CCGGACGCAAAGCAGCAGCCATGTACTCGAGTACATGGCTGCTGCTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163075.1-900s21c1
Sequence:CCGGCAGCGTGCACTGTTCGTATTTCTCGAGAAATACGAACAGTGCACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163075
C17orf99 MISSION shRNA Lentiviral Transduction Particles
chromosome 17 open reading frame 99
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-642s21c1
Sequence:CCGGAGGCTGCAAACAACGCCAATGCTCGAGCATTGGCGTTGTTTGCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-331s21c1
Sequence:CCGGTCCAGACCTGCTCACCTACTTCTCGAGAAGTAGGTGAGCAGGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-138s21c1
Sequence:CCGGTGGTCTCCATTGCCTACAAAGCTCGAGCTTTGTAGGCAATGGAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163075.1-832s21c1
Sequence:CCGGACGCAAAGCAGCAGCCATGTACTCGAGTACATGGCTGCTGCTTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163075.1-900s21c1
Sequence:CCGGCAGCGTGCACTGTTCGTATTTCTCGAGAAATACGAACAGTGCACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)