EMAIL THIS PAGE TO A FRIEND

C18orf21

chromosome 18 open reading frame 21

29 Gene Product Result for
Synonyms: HsT3108 PNAS-131 XTP13
UniProtKB ID: Q32NC0, Q6GW03, Q9BXV6, Q9BXW2
Gene ID:
chicken(420954) chromosome 2 open reading frame, human C18orf21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031446 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077871 MISSION® esiRNA esiRNA human C18orf21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031446 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224384 predicted 527
2 SASI_Hs01_00224385 predicted 526
3 SASI_Hs01_00224386 predicted 674
4 SASI_Hs01_00224387 predicted 457
5 SASI_Hs01_00224388 predicted 457
6 SASI_Hs01_00224389 predicted 540
7 SASI_Hs01_00224390 predicted 469
8 SASI_Hs01_00224391 predicted 231
9 SASI_Hs01_00224392 predicted 544
10 SASI_Hs02_00358856 predicted 647
11 SASI_Hs01_00224383 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031446
VALIDATED
C18orf21 MISSION shRNA Bacterial Glycerol Stock
chromosome 18 open reading frame 21
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-191s21c1
Sequence:CCGGCACTTCGTCGCACGATGATAACTCGAGTTATCATCGTGCGACGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-777s21c1
Sequence:CCGGGATGTCAATTCTGAAACTAAACTCGAGTTTAGTTTCAGAATTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031446.3-486s21c1
Sequence:CCGGCCTGCCACTCCTACAAGTAAACTCGAGTTTACTTGTAGGAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-456s21c1
Sequence:CCGGAGAAGCTTTGTGTCAACATTGCTCGAGCAATGTTGACACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-325s21c1
Sequence:CCGGATCGAGAAGCGAGAAACTATACTCGAGTATAGTTTCTCGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031446.2-790s1c1
Sequence:CCGGCTTGGCATCCTTCAGTGTTTACTCGAGTAAACACTGAAGGATGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031446
VALIDATED
C18orf21 MISSION shRNA shRNA Plasmid DNA
chromosome 18 open reading frame 21
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-191s21c1
Sequence:CCGGCACTTCGTCGCACGATGATAACTCGAGTTATCATCGTGCGACGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-777s21c1
Sequence:CCGGGATGTCAATTCTGAAACTAAACTCGAGTTTAGTTTCAGAATTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031446.3-486s21c1
Sequence:CCGGCCTGCCACTCCTACAAGTAAACTCGAGTTTACTTGTAGGAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-456s21c1
Sequence:CCGGAGAAGCTTTGTGTCAACATTGCTCGAGCAATGTTGACACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-325s21c1
Sequence:CCGGATCGAGAAGCGAGAAACTATACTCGAGTATAGTTTCTCGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031446.2-790s1c1
Sequence:CCGGCTTGGCATCCTTCAGTGTTTACTCGAGTAAACACTGAAGGATGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031446
VALIDATED
C18orf21 MISSION shRNA Lentiviral Transduction Particles
chromosome 18 open reading frame 21
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-191s21c1
Sequence:CCGGCACTTCGTCGCACGATGATAACTCGAGTTATCATCGTGCGACGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-777s21c1
Sequence:CCGGGATGTCAATTCTGAAACTAAACTCGAGTTTAGTTTCAGAATTGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031446.3-486s21c1
Sequence:CCGGCCTGCCACTCCTACAAGTAAACTCGAGTTTACTTGTAGGAGTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-456s21c1
Sequence:CCGGAGAAGCTTTGTGTCAACATTGCTCGAGCAATGTTGACACAAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031446.3-325s21c1
Sequence:CCGGATCGAGAAGCGAGAAACTATACTCGAGTATAGTTTCTCGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031446.2-790s1c1
Sequence:CCGGCTTGGCATCCTTCAGTGTTTACTCGAGTAAACACTGAAGGATGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks